Frozen tissue blocks were sectioned at a width of 8 μm. All staining was performed using a BOND-MAX automatic tissue stainer (Leica Biosystems, Buffalo Grove, IL). ZEB1 expression was assessed using a rabbit polyclonal ZEB1 antibody (Sigma-Aldrich) at 1:200 dilution and visualized using antibody horseradish peroxidase and 3,3′-diaminobenzidine (DAB). ZEB1 expression was labeled as being negative, weak, moderate or strong as determined by the number of positive cells in the specimen. Staining intensity was determined by a board-certified neuropathologist who was blinded to tumor genotype.
Zeb1 antibody
Manufactured by Merck Group
The ZEB1 antibody is a laboratory research tool used for the detection and analysis of the ZEB1 protein in biological samples. ZEB1 is a transcription factor that plays a crucial role in the epithelial-mesenchymal transition (EMT) process. The antibody can be used in various applications, such as Western blotting, immunohistochemistry, and immunocytochemistry, to study the expression and localization of the ZEB1 protein in cells and tissues.
Automatically generated - may contain errors
3 protocols using zeb1 antibody
1
Immunohistochemical Analysis of ZEB1 Expression
2
Chromatin Immunoprecipitation of Zeb1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was carried out by using the SimpleChIP® Chromatin IP Kit (Cell Signaling) according to the manufacturer's instructions. Briefly, crosslinking was performed in cell culture medium containing 1% formaldehyde with gentle rotation for 10 min at room temperature. Fixation was stopped by the addition of glycine (125 mM final concentration). Fixed cells were then washed and digested by micrococcal nuclease. The nuclear pellet was suspended in chromatin immunoprecipitation (ChIP) buffer and sheared by sonication. The sheared chromatin was then immunoprecipitated with the Zeb1 antibody (Sigma‐Aldrich, HPA027524) or the control IgG (Cell Signaling), bound to the Protein G Magnetic Beads. The immunoprecipitated chromatins were then eluted with ChIP elution buffer. The DNA fragments were released by treatment of ribonuclease A and then proteinase K at 65°C for 2 h. The released DNA fragments were purified with columns and amplified by site‐specific primers by qPCR. Five percent of the chromatin extract was set aside for input. All ChIP signals were normalized to the input. The following Ckmt1 primers were used: 5′‐AAGCGCTTTTCCAAATTTCC‐3′ (sense) and 5′‐CCTGAGAAAGCTACTCTCCCTTT‐3′ (antisense).
3
Quantitative IHC Analysis of ELK3 and ZEB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After depara nated and dehydrated, the TMAs were boiled in sodium citrate solution (0.01 M, pH 6.0) for 15 min. Then 3% hydrogen peroxide was used to block endogenous peroxidase activity. Next, the TMAs were incubated with ELK3 antibody (1:200, Sigma) and ZEB1 antibody (1:200, Sigma) respectively at 4°C overnight. Next day, the TMAs were incubated with secondary antibody for 1 h at room temperature. IHC staining scores were based on staining intensity and percentage of positively stained cells. The staining intensity was divided into four levels, 0 (negative staining), 1 (weak staining), 2 (moderate staining) and 3 (strong staining). Percentage of positively stained cells was scored as 0 (0-10%), 1 (10%-25%), 2 (25%-50%), 3 (50%-75%) and 4 (75%-100%). The nal score was acquired by multiplying the above two scores. Total score of ≤ 4 indicated low expression and > 4 indicated high expression. The score was assessed by three pro cient pathologists independently.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!