Image lab image analysis software

cf‐mDNA from 200 μL plasma was isolated in triplicate (for most samples) using a Qiamp DNA Mini DNA extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, with elution into a 200 μL volume. Initial pilot polymerase chain reaction (PCR) amplifications suggested that mDNA was detected using several human mDNA gene primer pairs previously described (Zhang et al. 2010), while nuclear DNA was not detected using primers for human RAG2 (FOR, RAG2R GCACAGTCTTGCCAGGAGGAATC; REV, hRAG2REV TCTTTGGGGAGTGTGTAGAGC). Additionally, no bacterial 16s rDNA was detected (Zhang et al. 2010); 1 μL of a 1:15 dilution of DNA was amplified using 30 cycles of PCR (55°C annealing) with primers designed to detect human mitochondrial CytC oxidase subunit III (Zhang et al. 2010). Reactions were run on 1.5% agarose gels stained with EtBr, imaged on a ChemiDoc Gel Imager (BioRAD, Hercules, CA), and quantitated using Image Lab image analysis software (BioRAD, Hercules, CA). Dilution of DNA prior to analysis allowed amplification and detection within the linear range of the PCR assay and imager detection sensitivity.