Rna easy spin kit

Total RNA was isolated using the RNA Easy-spin kit (Intron Biotechnology Inc., Seongnam-Si, Korea) and reverse transcribed using random primers and the StrataScript reverse transcriptase kit (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions. qRT-PCR was carried out using 7500 Real-Time PCR System (Applied Biosystmes, Forster City, CA, USA) with SYBR Green PCR master mix (Thermo Fisher Scientific, Waltham, MA, USA). All reactions were performed in triplicate, and were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The relative mRNA expression levels were calculated using the comparative quantification method. The primers used in this experiment were as follows: p21, 5′–GTGGAGAGCATTCCATCCCT–3′ and 5′–TGGATGCAGCTTCCTCTCTG–3′; p53 upregulated modulator of apoptosis (PUMA), 5′–ACTGTGAATCCTGTGCTCTGCC–3′ and 5′–CAAATGAATGCCAGTGGTCACAC–3′; and ERα, 5′–TCTACTTTGCCAGCAAACTGGTGC–3′ and 5′–TGTCCAGCCCATGATGGTTCTGAT–3′.

Total RNA was isolated using an RNA EasySpin kit (Intron Biotechnology, Seongnam-si, Gyeonggi-do, Republic of Korea) according to the manufacturer’s instructions. cDNA synthesis was performed using a cDNA synthesis kit (primescript^® RTreagent kit, Takara, Kusatsu, Shiga, Japan) to convert total RNA into cDNA. For real-time PCR, the primers for various genes were designed in Primer-BLAST (NCBI, Bethesda, MD, USA). The primers used were as follows: E-cadherin (5′-TGCCCAGAAAATGAAAAAGG-3′, 5′-GTGTATGTGGCAATGCGTTC-3′), N-cadherin (5′-CCATCACTCGGCTTAATGGT-3′, 5′-GATGATGATGCAGAGCAGGA-3′), MMP2 (5′-ACATCAAGGGCATTCAGGAG-3′, 5′-GCCTCGTATACCGCATCAAT-3′), MMP9 (5′-CATCGTCATCCAGTTTGGTG-3′, 5′-TCGAAGATGAAGGGGAAGTG-3′), COL1A1 (5′-AGCCAGCAGATCGAGAACAT-3′, 5′-TCTTGTCCTTGGGGTTCTTG-3′), ZEB1 (5′-TGCACTGAGTGTGGAAAAGC-3′, 5′-TGGTGATGCTGAAAGAGACG-3′), and GAPDH (5′-CGCGGGGCTCTCCAGAACATCATCC-3′, 5′-CTCCGACGCCTGCTTCACCACCTTCTT-3′). Real-time PCR was performed using a real-time PCR kit (EBT-1801; HiPi Real-Time PCR 2x Master Mix, ELPIS Bio, Daedeok-gu, Daejeon, Republic of Korea), and all samples were normalized using the ΔΔCt method. In addition, numerical values for all expression levels were expressed as fold changes. All reactions were repeated three times, and relative expression levels and SDs were calculated using Microsoft Excel (Office 365).