Xp bead purification

mRNA was isolated from 2 ug of total RNA by poly-dT25 enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module according to the manufacturer's instructions and eluted in 15 ul 2-times first-strand cDNA synthesis buffer (NEBNext, NEB). After chemical fragmentation for 15 min at 94°C, the sample was directly subjected to the workflow for strand-specific RNA-Seq library preparation (Ultra Directional RNA Library Prep, NEB). After ligation of custom adaptors, unused adapters were depleted by a 1-times XP-bead purification (Beckman Coulter); adaptor-oligo1: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′, adaptor-oligo2: 5′-P-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′. Indexing was done during the following PCR enrichment (15 cycles) using custom amplification primers, carrying the index sequence indicated with ‘NNNNNN’; primer1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, primer2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, primer3: CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTT. After two more 1-times XP-bead purifications, libraries were quantified using the Qubit dsDNA HS Assay Kit (Invitrogen). For Illumina flowcell production, samples were equimolarly pooled and distributed on all lanes used for 75-bp single-read sequencing on Illumina HiSeq 2000.

Only total RNA with RNA-integrity numbers ≥ 9.5 was used. mRNA was isolated from 370 ng DNAse treated total RNA using the Next rRNA depletion Kit (New England Biolabs) according to the manufacturer’s instructions. Samples were subjected to the workflow for strand specific RNA-Seq library preparation (Next Ultra II Directional RNA Library Prep, New England Biolabs). For ligation, custom adaptors were used (Adaptor-Oligo 1: 5'-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-3', Adaptor-Oligo 2: 5'-P-GAT CGG AAG AGC ACA CGT CTG AAC TCC AGT CAC-3'). After ligation adapters were depleted by an XP bead purification (Beckman Coulter) by adding bead in a ratio of 1:0.9. Unique dual indexing was done during the following PCR enrichment (12 cycles) using custom amplification primers carrying the index sequence indicated with ‘NNNNNNN’ (Primer 1: AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T, Primer 2: CAA GCA GAA GAC GGC ATA CGA GAT NNNNNNNN GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC T). After two more XP beads purifications (1:0.9), libraries were quantified using the Fragment Analyzer (Agilent). Libraries were equimolarly pooled before sequencing them on an Illumina NovaSeq 6000 system in 100 bp paired-end mode to a depth of at least 40 million fragments.