The 150 ng of small RNAs isolated before MyOne C1 capture were lyophilized dry and then T4 PNK mix (2 μL 5× buffer (500 mM Tris HCl pH 6.8, 50 mM MgCl2, 50 mM DTT), 1 μL T4 PNK (NEB), 1 μL FastAP (Thermo Fisher Scientific), 0.5 μL SUPERaseIn, and 5.5 μL water) was added for 45 min at 37°C. Next, a pre-adenylated-3′linker was ligated by adding 3′Ligation Mix (1 μL of 3 μM L3-Bio_Linker (Flynn et al., 2016 (link)), 1 μL RNA Ligase I (NEB), 1 μL 100 mM DTT, 1 μL 10× RNA Ligase Buffer (NEB) and 6 μL 50% PEG8000 (NEB)) to the T4 PNK reaction and incubating for 4 h at 25°C. Unligated L3-Bio_Linker was digested by adding 2 μL of RecJ (NEB), 1.5 μL 5′ Deadenylase (NEB), 3 μL of 10× NEBuffer 1 (NEB) and incubating the reaction at 37°C for 60 min. Ligated RNA was purified with Zymo columns as described above and lyophilized dry. cDNA synthesis, enrichment of cDNA:RNA hybrids, cDNA elution, cDNA circularization, cDNA cleanup, first-step PCR, PAGE purification, and second-step PCR took place exactly as previously describe (Zarnegar et al., 2016 (link)).
T4 pnk
Manufactured by New England Biolabs
Sourced in United States, United Kingdom
T4 PNK is a DNA kinase enzyme derived from bacteriophage T4. It catalyzes the transfer of the gamma-phosphate from ATP to the 5' hydroxyl terminus of DNA or RNA, producing a 5' phosphorylated product.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by New England Biolabs (39 mentions)
γ 32p atp, by PerkinElmer (31 mentions)
Quick ligase, by New England Biolabs (20 mentions)
T4 ligation buffer, by New England Biolabs (16 mentions)
T4 ligase, by New England Biolabs (15 mentions)
Trizol, by Thermo Fisher Scientific (11 mentions)
Antarctic phosphatase, by New England Biolabs (10 mentions)
T4 rna ligase 1, by New England Biolabs (10 mentions)
Fastap, by Thermo Fisher Scientific (8 mentions)
Microspin g 25 column, by GE Healthcare (8 mentions)
5 deadenylase, by New England Biolabs (7 mentions)
Qiaquick gel extraction kit, by Qiagen (7 mentions)
Storage phosphor screen, by GE Healthcare (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
T4 dna polymerase, by New England Biolabs (6 mentions)
T4 rna ligase, by New England Biolabs (6 mentions)
Lenticrispr v2, by Addgene (6 mentions)
Klenow dna polymerase, by New England Biolabs (5 mentions)
G 25 column, by GE Healthcare (5 mentions)
Nextseq 500, by Illumina (5 mentions)
345 protocols using t4 pnk
1
Small RNA Library Preparation Protocol
2
Radiolabeling DNA Primer for RT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer DNA was 5′ end labeled in 10 μl reactions in a T4 PNK mix (1 μl 10× T4PNK reaction buffer, 2 μl 100 mM DNA primer, 5 μl nuclease free water, 1 μl γ-32P-ATP, 1 μl T4 PNK, NEB). The reaction was allowed to proceed for 2 h at 37°C. Reactions were stopped by the addition of 5 μl of Gel Loading Buffer II. The reaction was loaded onto a 15% denaturing PAGE gel. The band of interest was visualized by a phosphorimager (Typhoon, GE healthcare). The resulting band was excised and eluted overnight in 400 μl of 300 mM KCl. Resulting solution was EtOH precipitated and dissolved to 8000 counts per minute (cpm)/μl for further use in reverse transcription.
3
Small RNA Modification and Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
50 ng indicated synthetic or isolated sRNAs, 1 μl 10 × CutSmart buffer, 20 U recombinant ribonuclease inhibitor, 1 U shrimp alkaline phosphatase and RNase-free water were mixed in a total volume of 10 μl, and incubated at 37 °C for 30 min. After heat inactivation at 65 °C for 20 min, the samples were used for ligation assay or RNA polyadenylation assay.
50 ng indicated synthetic or isolated sRNAs, 1 μl 10 × T4 Pnk reaction buffer, 20 U recombinant ribonuclease inhibitor, 10 U T4 Pnk (New England Biolabs) and RNase-free water were mixed in a total volume of 10 μl, and incubated at 37 °C for 30 min. After heat inactivation at 65 °C for 20 min, the samples were used for ligation assay or RNA polyadenylation assay.
50 ng indicated synthetic or isolated sRNAs, 1 μl 10 × T4 Pnk reaction buffer, 20 U recombinant ribonuclease inhibitor, 10 U T4 Pnk (New England Biolabs) and RNase-free water were mixed in a total volume of 10 μl, and incubated at 37 °C for 30 min. After heat inactivation at 65 °C for 20 min, the samples were used for ligation assay or RNA polyadenylation assay.
4
Synthesis and Handling of RNA Oligonucleotides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA oligonucleotides for siGP, shGP, saiGP, sip53, shp53 and saip53 used for transfection were chemically synthesized by Integrated DNA Technologies (IDT). For shRNA and saiRNA, the resuspended oligonucleotides were heated to 95 °C for 5 min and snap-cooled in an ice-water bath to eliminate dimers. For siRNA, 100 μM of the 21 nt single-stranded RNAs in the same volume of annealing buffer was heated to 60–65 °C for 5 min, centrifuged and slowly cooled to room temperature for 30 min to create double-stranded siRNAs. RNA ladders composed of 21, 24, 27, 30, 40 and 50 nt chemically synthesized RNA oligonucleotides that contained the common sequence (5′ AACUUCAGGGUCAGCUUGCCG -3′) were used for probing in the Northern blotting assay. The RNAs used for the self-cleavage assay of the HDV ribozyme were transcribed in vitro using the T7 RNA pol from DNA templates containing saiRNA-RZ or saiRNA-mRZ sequences. To remove 2′, 3′-cyclic phosphate from the 3′ end of the saiRNA, in vitro transcribed saiRNA-RZ products were treated with T4 PNK (NEB) under conditions deprived of ATP at 37 °C for 2 h. Then, T4 PNK was inactivated by incubating at 65 °C for 20 min. The RNA oligonucleotides are listed in Supplementary Methods .
5
Purification and Radiolabeling of Nucleic Acid Substrates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA used in this study were ordered from Integrated DNA Technologies (IDT) (Supplementary Table 1 ). RNA substrates were purified by gel extraction from 12% (v/v) urea-denaturing PAGE (0.5X TBE) and ethanol precipitation as described previously40 (link). All DNA substrates were synthesized by IDT and purified as described above. Radiolabeled RNA substrates were prepared by 5’-end-labeling with T4 PNK (NEB) in the presence of gamma 32P-ATP. For 3’-end-labeled substrates, the crRNA was labeled with T4 RNA Ligase 1 (NEB) in the presence of 32P-PcP. Radiolabeled DNA substrates were prepared by 5’-end-labeling with T4 PNK (NEB) in the presence of gamma 32P-ATP. For dsDNA substrates, non-target strand or target-strand was first 5’-end-labeled before annealing a 1.2-fold molar excess of the complementary strand at 95°C for 3 min in 1X hybridization buffer (20 mM Tris-Cl, pH 7.5, 150 mM KCl, 5 mM MgCl2, 1 mM DTT) followed by slow-cooling to room temperature.
6
Characterizing RNA-Protein Interactions by EMSA
7
Enriching 3' Blocked RNA Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To enrich RNA species with blocked 3’, input RNA (300 ng of total ESC RNA, 75 ng of < 200 nts ESC RNA, or 75 ng of total sperm RNA) was first diluted in 38.5 μL of water and heat-denatured at 70°C for 2 min, followed by quick cool down at 4°C. To generate 5’P and 3’OH ends, 11.5 μL of PNK mix [1X T4 PNK reaction buffer, 1 mM ATP, 1 U/μL T4 PNK (New England Biolabs, Cat no M0201S); concentrations refer to a final volume of 50 μL] were added, and samples were incubated at 37°C for 30 min. 1 mL of TriPure was added, RNA was purified following the standard protocol, and resuspended in 14.5 μL of water. To polyadenylate the end-repaired RNA, 5.5 μL of EPAP mix [1X E. coli Poly(A) Polymerase Reaction Buffer, 1 mM ATP, 0.25 U/μl E. coli Poly(A) Polymerase (Cat no, NEB), 2 U/μl RNase inhibitor, murine (Cat no, NEB); concentrations refer to a final volume of 20 μL] were added, and samples were incubated at 37°C for 10 min. Polyadenylation reaction was stopped by adding EDTA to a final concentration of 10 mM. To deplete polyadenylated RNAs, 100 μL of Dynabeads Oligo(dT)25 were added to the sample and hybridization was carried at 25°C for 25 min. Flow-through was collected and RNA was purified with TriPure following standard protocol. As control, bead-bound RNA was also extracted using the same procedure. Fractionated RNA was analyzed on 9% denaturing (urea) polyacrylamide gels.
8
Proximity Barcoding Ligation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Beads were resuspended in 76 µl T4 PNK reaction buffer (97.2 mM Tris pH 7, 13.9 mM MgCl2, 1 mM ATP), 3 µl T4 PNK (NEB catalog no. M0201B), 1 µl Rnase inhibitor, and incubated at 37 °C for 20 min with interval mixing (1,200 rpm). After PNK treatment, samples were washed with 500 µl high salt buffer (1×) followed by low salt buffer (3×). Proximity barcode ligations were carried out in 150 µl T4 ligation reaction mix (11 µl T4 ligase (NEB catalog no. M0437B-BM), with 94 µl ligation buffer (75 mM Tris pH 7.5, 16.7 mM MgCl2, 5% DMSO, 0.00067% Tween 20, 1.67 mM ATP, 25.7% PEG8000), 2 µl RNase inhibitor and 43 µl water) at room temperature for 45 min with interval mixing (1,200 rpm). Samples were again washed with high salt buffer (1×) and low salt buffer (2×). Chimeric RNA barcode molecules were eluted from the bead by incubating with 127 µl ProK digestion solution (17 µl ProK (NEB catalog no. P8107B), 110 µl (100 mM Tris pH 7.5, 50 mM NaCl, 10 mM EDTA, 0.2% SDS)) at 37 °C for 20 min followed by 50 °C for 20 min with interval mixing (1,200 rpm). Samples were placed on the Dynamagnet and supernatants were transferred to a clean tube. Samples were cleaned up with Zymogen RNA clean and concentrator following manufacturers protocol and eluted in 10 µl.
9
3' Adaptor Ligation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
6μg of DNA-free total RNA were used for dephosphorylation by T4PNK (NEB®) in Buffer: 400mM Tris-HCl pH6.5, 400mM MgAc, 20mM Mercaptoethanole. Dephosphorylated, purified RNA was phosphorylated by Calf intestinal phosphatase (NEB®). 5pmol of 3’ adaptor (AAUGGACUCGUAUCACACCCGACAA , Thermo Scientific®) were phosphorylated using T4PNK (NEB®). After extraction by Phenol-Chloroform RNA ligation was performed at 17°C over night using T4 RNA ligase (NEB®). The ligation reaction was purified by PCl-extraction and cDNA was synthesized using random nonamers and Protoscript RT II (NEB®). For amplification target-specific forward primers and an adapter-specific reverse primer were used. PCR-products were cloned into pGEM-T Easy vector (Promega®) and sequenced.
10
Pre-miRNA Binding Assay with NF90/45
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pre-miRNAs (1 pmol for each) were prepared as above from microprocessing assays and treated using CIP (NEB) in a 20 μl reaction system and then inactivated at 80°C for 2 min. The pre-miRNAs were then radioactively labeled as follows: 20 μl of de-phosphorylated RNA, 3 μl of 10x T4 PNK buffer, 3 μl of 32P-γ-ATP, 1 μl of T4 PNK (NEB) in a 30 μl reaction system and incubated at 37°C for 30 min. RNA were then purified by G-25 spin column (Fisher Scientific) and EDTA was added to 0.1 mM. RNA was heated to 95°C for 2 min and immediately chilled on ice. These oligos were incubated with different amounts (0, 0.5 or 2 ug) of recombinant NF90/45 proteins, 4 μl of 5× EMSA binding buffer (5×: 100 mM HEPES pH 7.9, 375 mM KCl, 2.5 mM DTT, 0.05% Tween 20, 50% glycerol), and water up to 20 μl. The binding reaction was incubated on ice for 30 min, followed by the addition of 2 μl of BlueJuice gel loading buffer (Invitrogen). Samples were then resolved on the pre-run 6% TBE retardation gel (ThermoFisher) at 100 V and then imaged.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!