Superdex 200 10 30 column

HA-8mer was synthesized as previously described (Kanekiyo et al., 2013 (link); Weaver et al., 2016 (link)). Briefly, plasmids were transiently transfected into FreeStyle 293-F cells in FreeStyle 293 Expression Medium. After 5 days of culturing in conditions described above, cell culture supernatants collected by centrifugation and concentrated using a tangential flow filtration setup with a 30 kDa cutoff. In 100 mL aliquots, the concentrate was mixed with 2 mL of PBS-equilibrated Erythrina cristagalli lectin-immobilized resin (EY Laboratories) at 4°C and incubated overnight with gentle agitation. The resin was then loaded onto a 1.5 × 20 cm glass Econo-Column (Bio-Rad) and washed with five column-volumes of PBS by gravity flow. HA-8mer particles were eluted with two column-volumes of 0.2 M D-lactose (Sigma-Aldrich) in PBS and concentrated in a centrifugal concentrator with a 100 kDa cutoff. Size-exclusion FPLC was then performed using a Superdex 200 10/30 column (GE Healthcare) and purified HA-8mer was again concentrated as before.
Recombinant HPV16 L1 (Abcam ab119880) and recombinant HBsAg AD (Abcam ab193473) were reconstituted following the manufacturer’s guidelines. Nanoparticle formation of the expected size was confirmed by dynamic light scattering.

To show that the purified proteins are non-aggregating, analytical SEC was performed using a superdex 200 10/30 column (GE Healthcare). The buffer contained 30 mm Tris/HCl, pH 7.5, 150 mm NaCl, 5 mm MgCl₂, and 3 mm DTT. For molecular mass determination the column was calibrated with standard proteins of known molecular mass: ferritin (440 kDa), aldolase (158 kDa), conalbumin (75 kDa), ovalbumin (43 kDa), carbonic anhydrase (29 kDa), and ribonuclease A (13.7 kDa). Protein samples (100 μm in 200 μl buffer) were injected onto the preequilibrated column, and the flow rate was sustained at 0.5 ml/min.

KirBac3.1 mutants were diluted to 0.03–4 mg ml⁻¹ (depending on the crosslinker) in crosslinking buffer (20 mM TRIS pH 8.0, 150 mM KCl and 0.02% (w/v) DDM) and crosslinked by addition of MTS-1-MTS, dibromobimane or CuSO₄ to 0.5 mM, 2.5 mM and 1 mM, respectively, followed by incubation at room temperature for 30 min. EDTA was added to 5 mM to the CuSO₄ crosslinking reaction and MMTS to 100 mM to the MTS-1-MTS and dibromobimane reactions. Excess crosslinking reagents were removed with Micro Bio-Spin 6 columns (BioRad) equilibrated in crosslinking buffer. The crosslinked tetramer was isolated from higher molecular weight species by size exclusion chromatography with a Superdex 200 10/30 column (GE) equilibrated with crosslinking buffer. Fractions corresponding the crosslinked KirBac3.1 tetramer were recovered and concentrated with a 100 kDa centrifugal concentrator (Millipore) to between 10 and 20 mg ml⁻¹, snap-frozen in liquid N₂ and stored at −80 °C as single use aliquots, until required.

Gel-filtration analysis of S₈-meSRK–S₈-SP11 interaction was performed on a Superdex 200 10/30 column (GE Healthcare). S₈-meSRK (10 μM), S₈-SP11 (30 μM), and the mixture in Buffer A were independently analyzed at 4 °C. Molecular marker (Bio-Rad) was also used for molecular size estimation. Full image of SDS-PAGE gel is shown in Supplementary Fig. 11.

For all SEC-MALS experiments using Lphn3^Lec–Olf, FLRT and Unc5 constructs, proteins were mixed in a 2:1:1 ratio and then concentrated to the desired concentration. Samples were loaded onto a Superdex 200 10/30 column (GE Healthcare) equilibrated in 10 mM Tris-HCl (pH 7.5) and 150 mM NaCl. The eluate was analysed using laser light scattering detected at 662 nm wavelength at eight scattering angles between 20.6° and 149.1° using a Heleos 8 instrument (Wyatt Technology, Germany). ASTRA 6.1 (Wyatt Technology) was used to calculate the molecular weights using the Zimm equation.

The crRNA of P. aeruginosa (CUAAGAAAUUCACGGCGGGCUUGAUGUCCGCGUCUACCUGGUUCA CUGCCGUAU AGGCAG, the spacer sequences underlined) and its short version (UCACGGCGGGCUUGAUGUCCGCGUCUACCU) containing a 30-nucleotide spacer (from +2 to +31 position of crRNA) were synthesized (Bioneer, South Korea). Each crRNA was mixed with ZmCsy3 at a protein to crRNA ratio of 11 to 1 and 5 to 1, respectively, and incubated for more than 2 h at 22°C. The mixtures were analyzed with a Superdex 200 10/30 column (GE Healthcare) equilibrated with 20 mM Tris pH 7.5, 150 mM NaCl, and 5% glycerol. The molecular weight of the eluates was estimated based on the positions of known molecular-weight proteins (ferritin, 440 kDa; aldolase, 158 kDa; ovalbumin, 44 kDa; carbonic anhydrase, 29 kDa; ribonuclease A, 13.7 kDa).

Size exclusion chromatography was performed on a Superdex200 10/30 column (GE Healthcare) equilibrated in 50 mM Tris.HCl, pH 7.5, 150 mM NaCl at 0.4 ml/min. The column was followed in-line by a Dawn Heleos-II light scattering detector (Wyatt Technologies) and an Optilab-Rex refractive index monitor (Wyatt Technologies). Molecular mass calculations were performed using ASTRA 5.3.4.14 (Wyatt Technologies) assuming a dn/dc value of 0.186 ml/g.