Transzol up plus rna kit

Total RNA was isolated using a TransZol Up Plus RNA kit (catalog number ER501-01; Transgen, China). RNA was reverse transcribed using EasyScript one-step genomic DNA (gDNA) removal and cDNA synthesis supermix (catalog number AE311-01; Transgen, China). Quantitative PCR (qPCR) was performed in triplicate using 2× SYBR qPCR master mix (Bimake, Houston, TX, USA). The primers used for real-time quantitative RT-PCR (qRT-PCR) are listed in Table 3. All experimental data were obtained with a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific, USA) and analyzed with QuantStudio Design and Analysis Software version 1.4.3 based on the ΔΔC_T method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. To assess PHEV replication, standard-curve qPCR experiments were performed using the N gene of the PHEV genome as a standard. The following primers were designed based on the PHEV N gene used for quantification of the PHEV genome: 5′-TCTGGGAATCCTGACGAG-3′ (P1) and 5′-AGGCGCTGCAACACTTAC-3′ (P2).

In general, the larval midgut is the principal place to detoxify the exogenous 20E. Therefore, the RNA, which was extracted from the midgut collected at 3 h after 20 μg 20E treatment, was subjected to transcriptomic analysis. Each midgut sample was collected from five larvae and ground in liquid nitrogen to a powder. Total RNA was extracted using a TransZoL up Plus RNA Kit according to the manufacturer’s protocol (Beijing TransGen Biotech, Beijing, China). RNA purity was checked using a Nano Photometer spectrophotometer (Implen, Westlake Village, CA, USA). RNA 6000 Nano Assay Kit and Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) were implemented to assess RNA integrity. Then, 3 μg of total RNA per sample was used as input material for RNA sequencing. The transcriptome libraries were generated using Illumina TruSeq™ RNA Sample Preparation Kit (Illumina, San Diego, CA, USA) following the manufacturer’s recommendations. RNA-Seq based transcriptome profiling was performed by Biomarker Technologies Corporation (Beijing, China). NovaSeq 6000 platform was applied to generate 150 bp paired-end reads. Each biological sample was repeated two times. The raw data of RNA-seq has been deposited into China National Center for Bioinformation (ID: CRA006208).

The qRT-PCR was performed as described previously (15 (link)). Briefly, total RNA was extracted using TransZol Up Plus RNA Kit (Transgen, Beijing, China) following the manufacturer's instructions. 0.5 μg total RNA was reverse transcribed using the EasyScript® First-Strand cDNA Synthesis SuperMix (Transgen, Beijing, China). The mRNA expression levels were measured by TransStart® Tip Green qPCR SuperMix (Transgen, Beijing, China) on a Roche 480 real-time PCR system thermocycler. Each sample was analyzed in triplicates and target gene expression was analyzed by 2^−ΔΔCt method (16 (link)), following normalization with β-actin gene. The primers used are provided in Table 1.

Expression levels of E1 and GmFT2a/5a in wild type plants and T₂ homozygous mutants were analyzed under LD and SD conditions, respectively. Every 5-day interval after 10 days after emergence (DAE), at 10 am (4 h after light), the trifoliate leaves were sampled from plants with different genotypes under LD and SD conditions. Total RNAs were extracted using TransZol Up Plus RNA Kit (TransGen Biotech). For reverse transcription, the first-strand cDNA synthesis was performed using the TransScript First-strand cDNA Synthesis SuperMix Kit (TransGen, China). For qRT-PCR, gene expressions were examined using cDNA templates on an Applied Biosystems 7300 Real-Time PCR System. The relative gene expression levels followed the method (Pfaffl, 2001 (link)). The mRNA level of GmActin (Glyma18g52780) was used as a reference for normalization. Specific primers we used in this study were list in Supplementary Table 2. Three biological replicates were used for each gene.

To determine gene expression control by SimL, the WT, ΔSimL, and WT::SimL strains were grown in the fructose CSN induction medium for 10 days. The mycelia were harvested, washed twice with sterile water, and homogenized in liquid nitrogen for RNA extraction with the TransZol UP Plus RNA kit (Transgen Biotech, China) by following the manufacturer’s protocol. The RNA (20 μg each) was then converted to cDNA using the ReverTra Ace quantitative PCR (qPCR) real-time (RT) master mix (Toyobo Life Science, Japan). Semiquantitative RT-PCR analysis was performed using the primer pairs for different genes (Table S2). A β-tubulin gene (TINF09088) of T. inflatum was amplified as a reference. The conserved binding motif of the fungal basic leucine zipper (bZIP)-type transcription factor (TF) was identified to be 5′-TGACG-3′ (20 (link)). To examine the presence or absence of this motif, the promoter region (1 to 1.5 kb upstream of the start codon) of the cluster gene was scanned. Each identified motif was extracted together with its flanking sequences (five nucleotides) to generate the sequence logo using WebLogo 3 (38 (link)).

Total RNA was isolated from frozen persimmon tissues using the hot borate method27 (link), and TransZol Up Plus RNA Kit (Transgen Biotech, Beijing, China) was used to extract total RNA from Arabidopsis and tomato. First-strand cDNA was obtained using a PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, Japan). Based on the degenerate primers designed by Zhu et al.6 (link), a new conserved XTH gene region was amplified using material from persimmon fruit as a template. Subsequently, 3′- and 5′-rapid amplification of cDNA ends polymerase chain reactions (PCR) were performed as described in Han et al.27 (link), and the full-length cDNA of XTH was then amplified based on the 3′-end and 5′-end fragments. The primer sequences are listed in Table 1.

Total RNA was isolated using a Transzol Up Plus RNA Kit (Transgen Biotech, Beijing, China) following the manufacturer’s instructions. RNA degradation and contamination was monitored on 1% agaroes gels. RNA purity was detected using the NanoDrop 2000c spectrophotometer (Thermo Scientific, IL, USA). Reverse transcription was carried by HiScript® QRT SuperMix for qPCR(+gDNA wiper)(R123–1, Vazyme, Nanjing, China). Real-time PCR was performed using a StepOnePlus Real-time PCR Instrument (Applied Biosystems) in a 15 reaction system as described in the instructions of AceQTM qPCR SYBR® Green Master Mix (Q121–02, Vazyme, Nanjing, China). Reaction were incubated in a 96-well optical plate (Applied Biosystems) at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30s, 60°Cfor 30s, and 72 °C for 30s. Each sample was run in triplicate. Primer sequences were synthesized by Sangon Biotech (Shanghai, China) on the basis of the gene sequences obtained from the NCBI database. Primer sequences are lised in Table 1. Gene expression was quantified relative to β-actin expression using the 2^-ΔΔCT method.Table 1

Primers used in real-time PCR

Gene	Forward primer, 5′-3′	Reverse primer, 5′-3′	Product, bp
Itpr2	ATCAGATGCCTGCCTCATCG	GTTCTGGGAGCTGAATGGCT	115
Gnas	CAGCCCGAGCAAGAACCTTT	CGGGGATGGGCTCATTGTTA	105
β-actin	CCCATCTATGAGGGTTACGC	TTTAATTGTCACGCACGATTTC	150