To select optimal target sites for the AAVS1 locus, single guide RNA (sgRNA) sequences were designed using the CRISPRscan program (Moreno-Mateos et al., 2015 (link)). The sgRNA CCACTAGGGACAGGATTGGTGA was expressed from a TOPO vector containing the U6 promoter (addgene: 41824). Confluent iPSCs on feeders were pretreated 4 hr before nucleofection with 10 μM Rock inhibitor (Y-27632 dihydrochloride, Ascent Scientific, Asc-129). Single cells were generated from iPSC colonies by incubating with Accutase (Thermo Scientific, Waltham, MA), and 2 × 106 cells were nucleofected with 4 μg of pCAG-hCAS9-GFP (addgene: 44719), 3 μg of TOPO-sgRNA, and 2 μg of donor vector using Amaxa Human Stem Cell Nucleofector Kit2 (VPH-5022, Lonza, Walkersville, MD) with program B-016. After nucleofection, cells were recovered in iPSC-conditioned medium (iPSC medium incubated for 24 hr on feeder cells) supplemented with 20 ng/mL FGF2 (Prepotech, Rocky Hill, NJ) and 10 μM rock inhibitor. iPSCs were selected after 48 hr of nucleofection with 100 μg/mL G-418 (Invivogen, San Diego, CA). Approximately 14 days after selection of the iPSCs, single colonies were picked and genotyped using primers from Table S4 .
Amaxa human stem cell nucleofector kit 2
Manufactured by Lonza
The Amaxa Human Stem Cell Nucleofector® Kit 2 is a laboratory equipment designed for the transfection of human stem cells. It facilitates the introduction of DNA, RNA, or other macromolecules into the cells using an electrical pulse method.
Automatically generated - may contain errors
Lab products found in correlation
Amaxa nucleofector 2, by Lonza (2 mentions)
Stempro accutase, by Thermo Fisher Scientific (2 mentions)
Accutase, by Thermo Fisher Scientific (1 mentions)
Nucleofector 2b, by Lonza (1 mentions)
G418 disulfate aqueous solution, by Nacalai Tesque (1 mentions)
Nucleofector 2b device, by Lonza (1 mentions)
Matrigel, by BD (1 mentions)
Plasmocin, by InvivoGen (1 mentions)
Coated sixwell plates, by Corning (1 mentions)
Tryple, by Thermo Fisher Scientific (1 mentions)
6 protocols using amaxa human stem cell nucleofector kit 2
1
Targeted AAVS1 Locus Editing in iPSCs
2
Directed Differentiation of hESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ETV2 and GATA2 modified messenger RNAs (mmRNAs) were kindly provided by NHLBI Progenitor Biology Consortium RNA Core (http://www.progenitorcells.org/content/requesting-rnacore-service ). Nucleofection of H1 hESCs with modified messenger RNAs (mmRNAs) was performed using Amaxa Human Stem Cell Nucleofector® Kit 2 (Lonza). Prior to nucleofection, cells were washed with PBS and dissociated to a single cell suspension using StemPro Accutase (Invitrogen, Carlsbad, CA) as described above. For one nucleofection reaction 2×106 cells were resuspended in 100 μl of nucleofection reagent containing mmRNA (1.75 μg of both GATA2 and ETV2; 3.5 μg in total), transferred immediately to nucleofection cuvette and transfected using B-016 program on the Amaxa Nucleofector II (Lonza). After the procedure, cells were resuspended in 500 μl of mTeSR1 medium with Y-27632 ROCK inhibitor and transfered to matrigel coated six-well plates containing 2ml of mTeSR1 medium. After a 24 hours incubation, cells were collected and transfected a second time as described above. 24 hours after the second transfection, medium was change to growth factor-free basal TeSR1 medium containing SCF (100 ng ml−1), TPO (50 ng ml−1) and bFGF (20 ng ml−1).
3
Directed Differentiation of hESCs
4
Generation of Myogenic MELAS-iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We introduced a myogenic differentiation system34 (link) into MELAS-iPSCs using a piggyBac vector, PB200_hMyoD,35 (link) including (Tet-On)-MYOD-IRES-EGFP cDNA and a neomycin resistance gene. A01 MELAS-iPSCs were transfected with a transposase-expressing plasmid, pHL-EF1a-hcPBase34 (link) (1.5 μg), and PB200-hMyoD (1.5 μg) using Nucleofector 2b (Lonza) and an Amaxa human stem cell Nucleofector kit 2 (Lonza), according to the manufacturer’s protocol, and were then plated on feeder cells. Forty-eight hours after the transfection, a G418 disulfate aqueous solution (50 μg/mL; Nacalai Tesque) was added to select appropriate MyoD-iPSC clones with high EGFP expression.
5
Genetic Modification of H1 hESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H1 hESCs were cultured in mTeSR supplemented with 25 μg/ml plasmocin™ (InvivoGen) for 2 weeks and pretreated with 5 μM ROCK inhibitor Y27632 1 day prior to transfection. Next, donor vectors were delivered using the Amaxa™ human stem cell Nucleofector™ kit 2 (Lonza), according to the manufacturer’s instructions. Briefly, 1 × 106 single H1 hESCs were collected and resuspended in transfer buffer (82 μl Nucleofector solution and 18 μl supplement) mixed with a cocktail of 3 μg 717-pEF1-Cas9-wpre-polyA, 3 μg S479-pU6-AAVS1b vector, and 6 μg pD-AAVS1 (HA600)-EF1α-TPO-GFP or 6 μg pD-AAVS1 (HA600)-EF1α-GFP. Electroporation was performed using the “B-16” protocol of the Nucleofector™ 2b Device (Lonza). At 4 h and 12 h after electroporation, fresh mTeSR supplemented with 5 μM ROCK inhibitor Y27632 was added. At 24 h after electroporation, the medium was changed to fresh mTeSR without ROCK inhibitor Y27632 and was subsequently changed daily. After three passages, the GFP-positive H1 hESCs were enriched with flow cytometry-based sorting. To establish the GFP and TPO-GFP knock-in H1 hESC stable lines, 2 × 104 single cells were seeded on Matrigel (BD Biosciences)-coated six-well plates (Corning). Around 3– 5 days later, single clones expressing bright green fluorescence were selected for expansion and detection as reported previously [21 (link)].
6
Genetic Modification of Stem Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!