Total RNA was extracted from organ tissues (leaves, roots, stems, seeds, and flowers) and the extract was treated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A Power cDNA synthesis kit (iNtRON Biotechnology, Korea) was used to synthesize first-strand circular DNA (cDNA) from 1 μg total RNA according to the manufacturer’s instructions. Polymerase chain reaction (PCR) was used to confirm the specificity of gene-specific primers designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi? LINK_LOC=BlastHome) (Additional file 6 : Table S3). Diluted cDNAs were used as templates for semi-quantitative real-time (RT)-PCR analysis. Semi-qRT-PCR was performed as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of 1 min at 95 °C, 30 s at 58 °C, 1 min at 72 °C, and a final elongation step at 72 °C for 5 min. Quantitative real-time PCR (qRT-PCR) was performed using EvaGreen 2X qPCR Mastermix (ABM, Vancouver, BC, Canada) on a CFX-96 RT-PCR systems (Bio-Rad Laboratories Inc., Hercules, CA, USA) with three independent replicates. Gene expression was calculated as the fold change using the 2−ΔΔCT method [50 (link)].
Cfx96 rt pcr system
Manufactured by Bio-Rad
Sourced in United States, China, Japan
The CFX96 RT-PCR system is a real-time PCR detection system designed for gene expression analysis, genomic DNA quantification, and pathogen detection. It features a 96-well format and is capable of performing real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (18 mentions)
Iscript cdna synthesis kit, by Bio-Rad (9 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Iq sybr green supermix, by Bio-Rad (5 mentions)
Sybr premix ex taq 2, by Takara Bio (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Ssofast evagreen supermix, by Bio-Rad (3 mentions)
Cfx manager software, by Bio-Rad (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Aurum total rna mini kit, by Bio-Rad (2 mentions)
Qscript cdna supermix, by Quanta Biosciences (2 mentions)
Hiscript 2 q rt supermix, by Vazyme (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Trizol reagent, by Merck Group (2 mentions)
Minidawn treos, by Wyatt Technology (2 mentions)
Optilab rex, by Wyatt Technology (2 mentions)
Sybr green real time kit, by Takara Bio (2 mentions)
Iqtm sybr green supermix, by Bio-Rad (2 mentions)
81 protocols using cfx96 rt pcr system
1
RNA Extraction and Gene Expression Analysis
2
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation from cells treated for 24 h was done using TRIZOL.32 (link) The RNA was stored at −80 °C after
quantification using a multimode microplate reader (BioTek Synergy
H1) until further use. cDNA synthesis was done using the iScript cDNA
synthesis kit (BioRad) according to the manual provided by the manufacturer.
Reaction parameters: priming for 5 min at 25 °C, cDNA synthesis
for 20 min at 46 °C, reverse transcriptase inactivation at 95
°C for 1 min, and hold at 4 °C for infinity. Quantitative
RT-PCR was performed after mixing the SYBR green PCR master mix (BioRad)
with cDNA and gene-specific primers for NF-κB, RAGE, iNOS, MHC-II,
CD86, CD206, ARG1, and GAPDH (Supporting Table 1 ) and running the reaction in CFX 96 RT-PCR systems (BioRad,
California).33 (link) The results were expressed
as a fold increase relative to GAPDH.
quantification using a multimode microplate reader (BioTek Synergy
H1) until further use. cDNA synthesis was done using the iScript cDNA
synthesis kit (BioRad) according to the manual provided by the manufacturer.
Reaction parameters: priming for 5 min at 25 °C, cDNA synthesis
for 20 min at 46 °C, reverse transcriptase inactivation at 95
°C for 1 min, and hold at 4 °C for infinity. Quantitative
RT-PCR was performed after mixing the SYBR green PCR master mix (BioRad)
with cDNA and gene-specific primers for NF-κB, RAGE, iNOS, MHC-II,
CD86, CD206, ARG1, and GAPDH (
California).33 (link) The results were expressed
as a fold increase relative to GAPDH.
3
Quantification of mRNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from samples using TRIzol® (Sigma-Aldrich; Merck KGaA). Total RNA was reversed transcribed into cDNA using PrimeScript™ RT Master Mix (Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions. The temperature protocol using for RT was as follows: 37˚C for 15 min and 85˚C for 5 sec. Subsequently, qPCR was performed using SYBR-Green Supermix (Bio-Rad Laboratories, Inc.) and the Bio-Rad CFX 96 RT PCR system (Bio-Rad Laboratories, Inc.). The thermocycling conditions used for qPCR were as follows: Step 1: 95˚C for 30 sec; step 2: 95˚C for 5 sec, 60˚C for 30 sec (repeated for 39 cycles); step 3: 95˚C for 10 sec followed by 65˚C to 95˚C in 0.5˚C/5 sec increments. The following primers were used for qPCR: miR-141-3p (26 (link)) forward, 5'-CGTCGCTAACACTGTCTGGTAA-3' and reverse, 5'-GTGCAGGGTCCGAGGTATTC-3'; U6 forward, 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACGAATTTGCGTGTCAT-3'; lncRNA-ATB (27 (link)) forward, 5'-ACAAGCTGTGCAGTCTCAGG-3' and reverse, 5'-CTAGGCCCAAAGACAATGGA-3'; and GAPDH forward, 5'-AGCAAGAGCACAAGAGGAAG-3' and reverse, 5'-GGTTGAGCACAGGGTACTTT-3'. mRNA and miRNA expression levels were normalized to the internal reference genes GAPDH and U6, respectively. Quantification of mRNA and miRNA expression was performed by using the 2-ΔΔCq method (28 (link)).
4
Anthocyanin and Carotenoid Biosynthesis Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five unigenes related to the biosynthesis of anthocyanin and 10 unigenes associated with the biosynthesis of carotenoids were chosen for quantitative reverse transcription–polymerase chain reaction (qRT–PCR) analysis. For qRT–PCR, the TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) and a Bio-Rad CFX96 RT-PCR system (Bio-Rad, Hercules, CA, USA) were used with the following reaction conditions: denaturation at 94 °C for 60 s and 45 cycles of amplification (94 °C for 5 s, 60 °C for 15 s, and 72 °C for 10 s). The 2−ΔΔCt method was used for calculating the relative expression levels of target genes against the internal control [74 (link)]. To normalize the relative expression levels of target genes, the H. macrophylla actin gene was employed as a control [75 ]. Supplementary Table S1 lists the gene-specific primers. For each experiment, three biological and three technical replicates were used.
5
Transcriptome Analysis of hiPSC Cultures
6
RNA Extraction and qPCR Analysis
7
Quantitative Analysis of Conidiation Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze the expression of conidiation-associated genes, quantitative analysis was performed according to previous reports (Wang et al., 2019a (link); Wang Z. X. et al., 2021 (link)). Total RNA was extracted with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) from fungal samples cultured on PDA plates for 2.5 days (initial conidiation stage) by inoculation of 100 μl conidial suspensions. The quantitative PCR (qPCR) (specific primers in Supplementary Table 2 ) was conducted using a CFX96TM RT-PCR System (Bio-Rad, Hercules, CA, USA) with SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China). The relative expression levels of the genes were investigated using the 2−ΔΔCT method (Livak and Schmittgen, 2001 (link)).
8
Quantitative Analysis of Yeast Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of yeast strains cultivated in three M3 media for 12 h was extracted using the RNA simple Total RNA kit (Tiangen Biotech (Beijing) Co., Ltd.), following the manufacturer’s instructions. Subsequently, DNA elimination and reverse transcription were performed using the HiScript II QRT SuperMix (Vazyme Biotech Co., Ltd., Nanjing, China). Then, PCR was quantified on the CFX96TM RT-PCR system (Bio-Rad, Hercules, CA, USA) after adding the ChamQ Universal SYBR qPCR Master Premix (Vazyme Biotech Co., Ltd.). Finally, the relative expression levels of mRNA were determined using the 2−∆∆CT method [44 (link)]. Among them, ΔCTs were derived by the CTs (cycle thresholds) of the target genes (YAT, GOT1, his C, PDC, and ADH5) minus the CT of ENO1, which served as the housekeeping gene. ΔΔCTs were calculated by ΔCTs from the target genes minus the CT of the control gene. Fold changes were determined using the 2−∆∆CT method. The primers of related genes are listed in Table 2 .
9
Quantifying Mcl-1 Gene Expression in Trametinib-Treated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the HCT116 cells treated with Trametinib at the indicated time points using TRIzol reagent following the manufacturer's instructions. The SuperScript II RT Kit was used for cDNA synthesis. Real‐time PCR was performed with SsoFasrTM Probes Supermix (Bio‐Rad, Hercules, CA, USA) on a Bio‐Rad CFX96TM RT‐PCR System (35 cycles). The expression levels were evaluated by TaqMan RT‐PCR, and the results were plotted as the threshold cycle (Ct). The relative abundance of the target genes was determined using the comparative Ct method (ΔΔCt). Gene expression was assessed using the 2−ΔΔCt method. Primers: Mcl‐1, Forward: 5′‐GACCTGACAGACTACCTCAT‐3′, Reverse: 5′‐AGACAGCACTGTGTTGGCTA‐3′; and β‐actin, Forward: 5′‐ATGCTTCGGAAACTGGACAT‐3′, Reverse: 5′‐TGGAAGAACTCCACAAACCCA‐3′.
10
Detection of High-Risk HPV Types
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cases wherein HPV ISH was unavailable, real-time polymerase chain reaction (RT-PCR) was performed. Nucleic acids were extracted from 10-μm (× 5) paraffin tissue sections, and the CFX96TM RT-PCR system (Bio-Rad Laboratories, Hercules, CA, USA) and Anyplex II HPV28 Detection system (31744024, Seegene, Seoul, Korea) were used. Anyplex II HPV28 detection (A) detects the following high-risk HPV types: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!