Moloney murine leukemia virus reverse transcriptase mmlv rt kit

qRT-PCR was performed to obtain cDNA using the Moloney murine leukemia virus-reverse transcriptase (MMLV-RT) kit (Life Technologies) as previously described (Belhareth et al., 2018 (link)). qRT-PCR was realized using the SYBR Green Fast Master Mix (Roche Diagnostics, Meylan, France) and specific primers (designed using the Primer3 software).We used primers for CDH1 gene (forward: gaaggtgacagagcctctggat and reverse: gatcggttaccgtgatcaaaat) coding for the E-cad mRNA; CTNNB1 gene (forward: agcttccagacacgctatcat and reverse: cggtacaacgagctgtttctac) coding for the β-cat mRNA; and to the housekeeping gene β-actin (forward: aggaaggaaggctggaagag and reverse: ggaaatcgtgcgtgacatta). The qRT-PCR results obtained using the CDH1 and CTNNB1 probes were normalized to β-actin. Data were expressed as Log10 (2^ΔCt), where ΔCt = (Ct_Target−Ct_Actin). The threshold cycle (Ct) was defined as the number of cycles required to detect the fluorescent signal.

RT-PCR was performed in order to obtain cDNA using the Moloney murine leukemia virus-reverse transcriptase (MMLV-RT) kit (Life Technologies. Marseille. France) as previously described [18 (link)]. Specific genes found modulated by microarray or strongly involved in lymphoma according to prior work² were then selected and validated by q-PCR using specific primers listed in the S1 Table as well as the SYBR Green Fast Master Mix (Roche Diagnostics, Meylan, France). The results were normalized to housekeeping gene β-actin and expressed as fold change (FC) = 2^−ΔΔCt, which ΔΔCt = (Ct_Target—Ct_Actin)_assay—(Ct_Target—Ct_Actin)_control. The threshold cycle (Ct) was defined as the number of cycles required to detect the fluorescent signal. The expression of genes was considered as modulated when FC ≥ 1.5.