Mice were maintained on a 12-/12-h light/dark cycle with access to standard mouse chow (Sniff) and water ad libitum. Animals were aged between 6-8 weeks old at the time of the experiment, unless otherwise stated. C57BL/6JRj female mice were purchased from Janvier Labs. Nox2 knockout mice (B6.129S-Cybbtm1Din/J; Pollock et al., 1995 (link)) were initially purchased from The Jackson Laboratory and maintained as a heterozygous breeding colonies, Nestin-GFP mice (Yamaguchi et al., 2000 (link)), were obtained from Yamaguchi and colleagues and maintained as a homozygous colony, Dcx-GFP mice (Stock Tg(Dcx-EGFP)BJ224Gsat/Mmmh) were purchased from Mutant Mouse Resource and Research center and maintained as a homozygous colony (Gong et al., 2003 (link)). Gfap-GFP mice were acquired from the lab of Frank Kirchhoff (University of Saarland) and maintained as a homozygous colony (Nolte et al., 2001 (link)). Mice were housed in groups of at least two mice in standard polycarbonate cages (Type III, Techniplast, Germany), except for the animals with running wheels, which were singly-housed. All experiments were conducted in accordance with the applicable European regulations and approved by the responsible authority (Landesdirektion Sachsen). Detailed information on the genotype of the animals used for each experiment; the number of animals per sample and sample size is given in Table S5 .
B6.129s cybbtm1din j
Manufactured by Jackson ImmunoResearch
Sourced in United States, Montenegro
B6.129S-Cybbtm1Din/J is a mouse strain with a targeted mutation in the Cybb gene, which encodes the gp91phox subunit of the phagocyte NADPH oxidase. This strain is commonly used in research related to chronic granulomatous disease (CGD), an inherited disorder of the immune system.
Automatically generated - may contain errors
Lab products found in correlation
C57bl 6j, by Jackson ImmunoResearch (5 mentions)
C57bl 6, by Jackson ImmunoResearch (2 mentions)
Female c57bl 6jrj mice, by Janvier Labs (1 mentions)
Wt 000664, by Jackson ImmunoResearch (1 mentions)
Balb cbyj, by Jackson ImmunoResearch (1 mentions)
Serum separator tube, by BD (1 mentions)
Balb c mice, by Jackson ImmunoResearch (1 mentions)
C57bl, by Jackson ImmunoResearch (1 mentions)
Doxorubicin, by Cayman Chemical (1 mentions)
Gp91phox y, by Jackson ImmunoResearch (1 mentions)
C57bl 6j wt, by Jackson ImmunoResearch (1 mentions)
D01112603, by Research Diets (1 mentions)
Wild type c57bl 6 mice, by Orient Bio (1 mentions)
B6.129s2 alox15tm1fun j, by Jackson ImmunoResearch (1 mentions)
12 hete, by Cayman Chemical (1 mentions)
Streptozotocin (stz), by Merck Group (1 mentions)
C57bl 6j wild type control mice, by Jackson ImmunoResearch (1 mentions)
B6 sjl ptprca pepcb boyj cd45.1, by Jackson ImmunoResearch (1 mentions)
Inos b6.129p2 nos2tm1lau j, by Jackson ImmunoResearch (1 mentions)
B6.129x1 mpotm1lus j mpo, by Jackson ImmunoResearch (1 mentions)
27 protocols using b6.129s cybbtm1din j
1
Mouse Models for Neuroscience Research
2
CGD Mouse Model Development and Utilization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All studies were performed under the approval of the Lifespan Animal Welfare Committee (Protocol number 5017-19, Office of Laboratory Animal Welfare Assurance #A3922-01). These studies follow Public Health Service guidelines for animal care and use. The CGD mouse model was acquired from Jackson Laboratories (Bar Harbor, ME), strain B6.129S-Cybbtm1Din/J for in-house breeding. This strain was originally developed by knocking out the Cybb gene (gp91phox) to recapitulate the CGD phenotype. Female mice heterozygous for the knocked out Cybb gene (x-linked) were bred with wild-type males to yield hemizygous wild-type (WT) or knockout male progeny used in this study. Animals were housed in sterile caging until infection at 6-10 weeks old and provided access to water and standard chow ad libitum.
3
Cisplatin-induced Acute Kidney Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice deficient in Cybb, the gene encoding the gp91phox subunit of NOX2, (B6.129S-Cybbtm1Din/J, No. 002365) were purchased from Jackson Laboratory. C57BL/6 mice purchased from National Laboratory Animal Center were used as WT mice. All mice have been routinely backcrossed to C57BL/6 background, undergone genome-wide genotyping to confirm the genetic background, and housed in the animal facility of the Laboratory Animal Center at National Cheng Kung University. All mice were housed at the National Cheng Kung University Laboratory Animal Center and maintained under a temperature-controlled, 12 h light/dark cycle and specific pathogen-free conditions. We injected 25 mg/kg of cisplatin (CDDP) intraperitoneally into 8–10-week-old male mice, which were euthanized at 0 and 3 days after injection. Four to five mice were included in each group, and each experiment was repeated 2–3 times. All experimentation protocols were approved by the Institutional Animal Care and Use Committee (IACUC), at National Cheng Kung University.
4
NOX2 KO Mice in Animal Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult 3-month-old C5BL/6N male mice were obtained from Envigo (Prattville, AL) for use in this study. NOX2 KO (B6.129S-Cybbtm1Din/J; Stock number 002365) and WT (000664) mice of equivalent age and weight were obtained from Jackson Labs (Bar Harbor, ME). Mice were housed under humidity- and temperature-controlled conditions with free access to food and water. All animal experiments were approved by the Charlie Norwood VA Medical Center Institutional Animal Care and Use Committee.
5
Murine Serum Collection and Handling
6
Characterization of Nox2-Deficient Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
Nox2−/− (B6.129S-Cybbtm1Din/J, Stock No. 002365) and C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, Maine). Nox2−/− mice were backcrossed to C57BL/6 background for more than ten generations; therefore, C57BL/6 mice were used as a control in all experiments. PCR analysis was performed to validate the Nox2 gene knockout model using the following primers: 5′ AAGAGAAACTCCTCTGCTGTGAA 3′ and 5′ GTTCTAATTCCATCAGAAGCTTATCG 3′, provided by Jackson Laboratory. A breeding program was implemented to harvest fetal and postnatal mice. Animals in this study were handled in accordance with the Guide for the Care and Use of Laboratory Animals, published by the U.S. National Institutes of Health (8th edition, 2011). All procedures involving mouse handling and manipulation were in accordance with the guidelines of the Canadian Council of Animal Care and approved by the Animal Care Committee at Western University, Canada.
+ Expand
Nox2−/− (B6.129S-Cybbtm1Din/J, Stock No. 002365) and C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, Maine). Nox2−/− mice were backcrossed to C57BL/6 background for more than ten generations; therefore, C57BL/6 mice were used as a control in all experiments. PCR analysis was performed to validate the Nox2 gene knockout model using the following primers: 5′ AAGAGAAACTCCTCTGCTGTGAA 3′ and 5′ GTTCTAATTCCATCAGAAGCTTATCG 3′, provided by Jackson Laboratory. A breeding program was implemented to harvest fetal and postnatal mice. Animals in this study were handled in accordance with the Guide for the Care and Use of Laboratory Animals, published by the U.S. National Institutes of Health (8th edition, 2011). All procedures involving mouse handling and manipulation were in accordance with the guidelines of the Canadian Council of Animal Care and approved by the Animal Care Committee at Western University, Canada.
7
Angiotensin II-induced Hypertension in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Male C57BL/6J and Nox2-deficient (KO) (B6.129S-Cybbtm1Din/J, Stock number 002365, gp91phox-, Jackson Laboratory, Bar Harbor, Maine) mice (8–12 weeks of age) were provided with chow and water ad libitum and housed in pairs on a fixed 12-h light/dark cycle. At baseline, there were no differences in physical characteristics between WT and Nox2 KO mice. An osmotic minipump (Alzet model 2004, Alza Corporation, Palo Alto, Calif) was implanted under tribromoethanol/amylene hydrate (Avertin; 2.5% wt/vol, 10 μL/g body weight, i.p.) anesthesia to infuse AII (1000 ng kg−1 min−1) continuously for 4 weeks. Saline was used as vehicle. Mice were randomly divided into following 4 groups; WT + V (n = 8), KO + V (n = 6), WT + AII (n = 8), and KO + AII (n = 6). All experiments were performed under barrier condition. These assignment procedures were performed using numeric codes to identify the animals. All procedures and animal care were approved by our institutional animal research committee and conformed to the animal care guidelines for the Care and Use of Laboratory Animals at Hokkaido University Graduate School of Medicine.
8
Murine Model of Chronic Granulomatous Disease
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal protocols were reviewed and approved by the Mount Sinai Institutional Animal Care and Use Committee (IACUC). Six- to 8-week-old female BALB/c mice were purchased from Jackson Laboratory and housed under specific-pathogen-free conditions. Age-matched B6.129S-Cybbtm1Din/J (also known as gp91 phox−) mice were purchased from Jackson Laboratory. These mice possess a null allele for the 91-kDa subunit of oxidase cytochrome B and are a model for chronic granulomatous disease (CGD).
9
Isolation of Cardiomyocytes from WT and NOX2 KO Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animal protocols were approved by the Columbia University Institutional Animal Care and Use Committee and were carried out in accordance with the NIH guidelines for the care and use of laboratory animals. Wild type (WT) C57BL and B6.129S-Cybbtm1Din/J (NOX2 KO) mice were purchased from Jackson labs. Mice were 9–12 weeks old at the time of experiments. Isolation of cardiomyocytes was performed as previously described using isoflurane for anesthesia [2 (link)].
10
Doxorubicin-induced Cardiac Toxicity in Nox2 KO Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nox2 knockout (KO) (B6.129S-Cybbtm1Din/J, Stock No. 002365) and wild-type (WT) control mice (C57BL/6J, Stock No. 000664) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). 8–10 weeks old Nox2 KO and WT mice were randomly assigned to receive a single intraperitoneal injection of doxorubicin (15 mg/kg, Cayman Chemical Company, Ann Arbor, MI, USA) or equivalent volume of saline. The dose of doxorubicin used in this study was based on the previous report47 (link).
The study was approved by the Institutional Animal Care and Use Committee at Shanxi Medical University and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health. We confirm that the study is reported in accordance with ARRIVE guidelines.
The study was approved by the Institutional Animal Care and Use Committee at Shanxi Medical University and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health. We confirm that the study is reported in accordance with ARRIVE guidelines.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!