Mth rna ligase

To fragment DNA and digest DNA–RNA heteroduplexes, 16–20 μg of chromatin-associated nucleic acids were incubated for 45 min at 37°C with 100 mU/μl dsDNA Shearase Plus and 200 mU/μl RNase H in triplex buffer containing 10 mM DTT. 3′-Biotinylated DNA oligos (11 (link)) (Supplementary Table S3) were 5′-adenylated using Mth RNA ligase (NEB), bound to MyOne Streptavidin C1 Dynabeads (Invitrogen), and ligated to cellular RNA for 2 h at room temperature using 3–3.5 μg nucleic acids from chromatin preparations in 100 μl of a buffer containing 10% PEG, 0.1% Triton X-100, 500 U T4 RNA ligase 2, truncated KQ (NEB). After washing with triplex buffer containing 0.05% Tween-20, RNA-associated DNA was eluted in 100 μl triplex buffer containing 50 ng/μl RNase A (Thermo Fisher Scientific) for 30 min at 37°C and recovered by phenol/chloroform extraction. Ligated RNA was eluted with 2U of TURBO DNase (Thermo Fisher Scientific) for 30 min at 37°C.

HEK293 cells were crosslinked with 0.5 mg/mL AMT, or non-crosslinked, and total RNA from each condition was collected for U8 enrichment using five biotinylated antisense oligos (GGATTATCCCACCTGACGAT, CTCCGGAGGAGGAACAGGTA, CTCCAATCATCATGTTCTAA, GTTAATCACGTTTCATGCAT, and CAGGGTGTTGCAAGTCCTGA), designed using the published ChIRP method (Chu et al. 2012 (link)). The enriched target RNAs were treated with the mRNA decapping enzyme (NEB #M0608S). Ends of the enriched RNA were then ligated via proximity ligation by Mth RNA Ligase (NEB #M2611), followed by reverse crosslinking and adapter ligation (Zhang et al. 2021 (link)). cDNA was synthesized using a primer complementary to the adapter. PCR was performed using primer sets: F, GGACTTGCAACACCCTGATT; R, CGGAGGAGGAACAGGTAAGG. The positive PCR products from U8-U8 homodimer should be 72 bp.