Nucleospin rna plus

RNA from MDA-MB-231 was collected with NucleoSpin RNA Plus (MACHEREY-NAGEL). Then 1 μg of Collected RNA samples was used for RT-PCR with ReverTra Ace qPCR Mix (Toyobo Co, Ltd). qPCR assays were performed with QnantStudio 5 (Thermo Fisher Scientific) and THUNDERBIRD NEXT SYBR qPCR Mix (Toyobo Co, Ltd).
The primers used in MET mRNA quantification are
Forward: ACCTTTGATATAACTGTTTACTTGTTGCA,
Reverse: GCTTTAGGGTGCCAGCATTTTAG.
The primers used in GAPDH mRNA quantification are
Forward: GCTCTCTGCTCCTCCTGTTC,
Reverse: CGCCCAATACGACCAAATCC.

SH-SY5Y cells were seeded in 25 mL flasks in triplicate for each condition (control, vehicle, ipconazole 20 µM, and ipconazole 50 µM). After 24 h of the treatments, total RNA was obtained using NucleoSpin^®-RNA-Plus (Macherey-Nagel, Düren, Germany, based on the use of silica columns) according to the manufacturer’s instructions. Total RNA was quantified using a nanospectrophotometer (Microdigital, Seoul, Republic of Korea), obtaining A260/A280 ratios close to 2.0 in all samples. The cDNA synthesis was obtained from 1 µg of total RNA by retrotranscription using the qPCRBIO cDNA synthesis kit (PCR Biosystems, PA, USA) according to the manufacturer’s instructions. Finally, the cDNA was diluted in nuclease-free water (v:v, 1:2) and stored at −80 °C. Real-time PCR (qPCR) assays to assess the expression of genes related to cell death (Bax, Casp3, APAF1, BNIP3, and Bcl2), inflammasome (NLRP3, Casp1, and IL1β), inflammation (NFκB, TNFα, and IL6), and antioxidant capacity (NRF2, SOD, and GPx) were performed with a real-time PCR system (BioRad CFX, CA, USA), using ICgreen Mastermix (Nippon Genetics, Duren, Germany) according to the manufacturer’s instructions. For RT-PCR, primers with 400 nM concentrations were used, and the thermocycling protocol was: 95 °C for 2 min and 40 cycles of 5 s at 95 °C and 30 s at 60 °C.

For RNA-seq, total RNA was isolated using Tripure Isolation Reagent (Roche) and purified using NucleoSpin RNA Plus (#740984.50, Macherey–Nagel). Sample preparation, normalization and sequence analysis were requested to DNA Chip Research Inc. (Tokyo, Japan).

Total RNA was isolated by using the NucleoSpin RNA plus (Macherey-Nagel) according to the manufacturer’s instructions. Purified RNA (250 ng) was reverse transcribed into cDNA by using random primers (ThermoFisher Scientific) and SuperScript III (Invitrogen) reverse transcriptase, according to the manufacturer’s protocol. The cDNA was then subjected to qPCR using the gene-specific primers indicated in Table 1. qPCRs were performed in duplicate using Power SYBR green PCR master mix (ThermoFisher Scientific), according to the manufacturer’s protocol, on an Applied Biosystems 7500 real-time PCR system instrument. Reactions were performed as follows: 2 min at 50°C; 10 min at 95°C; 40 cycles of 15 s at 95°C and 1 min at 60°C; and finally, 15 s at 95°C, 1 min at 60°C, 30 s at 95°C, and 15 s at 60°C to build the melt curve. Gene expression levels were normalized to the Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) gene, and the results were calculated as fold changes in gene expression relative to mock-infected cells by using the delta–delta C_T (threshold cycle) method of analysis. Dilutions of plasmids containing the sequence amplified by each set of primers run in parallel were used to establish the corresponding standard curves.

Total RNA from the hippocampus, cerebellum, and cerebral cortex was extracted using Invitrogen TRIzol Reagent (Carlsbad, CA, USA), whereas RNA from the liver and cell culture was extracted using NucleoSpin RNA Plus (Macherey-Nagel), following the manufacturer’s protocols. RNA quality was determined using NanoDrop™ One/OneC (Thermo Fisher Scientific), where a 260/280 ratio of >2.0 and 260/230 ratio between 2.0–2.2 were considered as pure RNA.

Total RNA was prepared from E. coli cells using NucleoSpin RNA Plus (Macherey-Nagel). cDNA samples were synthesized using the PrimeScript RT reagent kit (TaKaRa Bio, Inc.). The primers used in qRT-PCR are shown in Table S2. The PCR assays were carried out in a RotorGene6500HRM (Qiagen) device using SYBR Premix Ex Taq 2 (TaKaRa Bio, Inc.). In each experiment, total DNA of E. coli (Affymetrix) was added to the reaction mixture. The number of PCR cycles was determined in order to obtain DNA within the linear amplification range from the amplification curve. The copy numbers of samples were obtained after quantitative amplification of the target gene. Threshold cycle (C_T) values of sample DNAs were normalized to the reference C_T values obtained using the known amount of E. coli DNA (91 (link)).