Spectramax id3 spectrophotometer

Genomic DNA was extracted in triplicate directly from 250 mg fresh soil (n = 60) using the NucleoSpin Soil^® kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. The quality of the extracted DNA was checked using 1% (w/v) agarose gels. Quantification of the extracted DNA was performed using a SpectraMax^® iD3 spectrophotometer (Molecular Devices LLC, Sunnyvale, CA, United States). The extracted DNA was stored at −20 °C until use.
Polymerase Chain Reaction and sequencing of bacterial 16S rRNA gene Hypervariable regions V3–V4 of the 16S rRNA gene were amplified from 1 ng of genomic DNA using a PCR thermal cycler (Agilent Surecycler 8800) with the forward primer CS1_341_F (ACACTGACGACATGGTTCTACACCTACGGGNGGCWGCAG) and the reverse primer CS2_805_R (TACGGTAGCAGAGACTTGGTCTCTGACTACCAGGGTATCTAATC) [78 (link)]. Two independent PCR reactions were performed per DNA sample.

As described earlier, the biofilm formation in untreated (control) and Ag-Cu bimetallic NPs treated C. albicans cells was estimated [37 (link)]. In brief: freshly grown yeast cells were inoculated (1 × 10⁶ cells/mL) in 96-well plates and incubated for 2 h at 37 °C without shaking. Post-incubation period, the media was removed, and wells were two times washed with fresh PBS followed by addition of sterile growth medium containing desired concentrations of NPs (¼ × MIC and ½ × MIC) and incubation at 37 °C for 24 h and 48 h. The outcome of NPs on C. albicans biofilm formation was estimated by semi-quantitative 2,3-Bis(2-methoxy-4-nitro-5-sulfo-phenyl)-2H-tetrazolium-5-carboxanilide (XTT (Invitrogen, Thermo Fisher Scientific, Eugene, OR, USA) reduction assay. For this assay, 1 mg/mL XTT and 0.4 mM menadione (SigmaAldrich, St. Louis, MO, USA) were prepared in fresh PBS and acetone, respectively. Afterward, a freshly prepared solution of XTT:menadione (20:1) was prepared and added to PBS washed pre-formed biofilms and kept in the dark for 3 h at 37 °C. Next, the wells were aspirated, and the colorimetric changes were recorded at 490 nm using SpectraMax iD3 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). The XTT reduction was directly proportional to the metabolic activity of cells embedded in C. albicans biofilms.

Mice feces were collected by restraining the animals, whereby they were allowed to defecate individually in sterile containers. The fecal pellets were then transferred under sterile conditions in microcentrifuge tubes, snap frozen, and stored at − 80 °C, until further processing. Fecal samples were collected at two time points: at the beginning (week 0) and at the end of the experiment (week 12). The fecal samples were thawed at 4 °C and a sample of ~ 150 mg was homogenized in a Fast-Prep 24 (MP Biomedicals, Irvine, CA, USA) bead homogenizer for DNA extraction using the SPINeasy DNA Kit for Feces (MP Biomedicals), according to the manufacturer’s protocol. The extracted DNA was electrophoresed on a 1% agarose gel and visualized for quality using the ChemiDoc imaging system (Bio-Rad, Hercules, CA, USA). DNA quality was further examined using a SpectraMax iD3 spectrophotometer (Molecular Devices, San Jose, CA, USA) and quantified using Qubit 4 (Thermo Fisher Scientific, Waltham, MA, USA).