Levels of mitochondrial calcium were quantified by two different approaches. Cells were seeded in 96 optical well plates (Eppendorf) and incubated for 24 h or 7 d with sFLG 5 µg/mL. In the first approach, cells were loaded for 30 min with 1 µM Calcein-AM (#C1430; Thermo Fisher) and 1 mM CoCl2 to quench the fluorescence corresponding to cytosolic Ca2+ as described before46 (link). After washing in fresh medium, images were acquired in a Cytation 5 Reader (Biotek) using a 20 × objective. The results were calculated with ImageJ 1.53 and are expressed as relative fluorescence units (RFUs) for each treatment (n = 3). In the second approach, cells were loaded for 30 min with 1 µM Fluo-4 and Mitotracker Red CMXRos (#M7512; Thermo Fisher). After washing in fresh medium images were acquired in a Cytation 5 Reader (Biotek) using a 20 × objective. The percentage of mitochondrial area colocalized with Fluo-4 signal was calculated with ImageJ 1.53 (colocalization plug-in). Results are expressed as the percentage of mitochondrial area colocalized per cell for each treatment (> 50 cells).
Cytation 5 reader
Manufactured by Agilent Technologies
Sourced in United States
The Cytation 5 is a multi-mode microplate reader that combines automated digital microscopy and microplate reading capabilities. It is designed for cell-based assays, protein and biomolecule detection, and quantitative imaging applications.
Automatically generated - may contain errors
Lab products found in correlation
Powerup sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Dual luciferase reporter assay system, by Promega (3 mentions)
Fluorobrite dmem, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin, by Corning (2 mentions)
L glutamine, by Corning (2 mentions)
Calcein am, by Thermo Fisher Scientific (2 mentions)
Take3 micro volume plate, by Agilent Technologies (2 mentions)
Iscript reverse transcription kit, by Bio-Rad (2 mentions)
Cfx touch real time pcr detection system, by Bio-Rad (2 mentions)
Polytron pt 3100 homogenizer, by Kinematica (2 mentions)
Mastercycler, by Eppendorf (2 mentions)
E z n a total rna kit 1, by Omega Bio-Tek (2 mentions)
Gene5, by Agilent Technologies (2 mentions)
Ren luc prl tk, by Promega (2 mentions)
H2dcfda, by Thermo Fisher Scientific (2 mentions)
Cell lysis buffer, by Merck Group (1 mentions)
Cathepsin b activity assay kit, by Abcam (1 mentions)
Phosphate buffered saline (pbs), by Merck Group (1 mentions)
6 well plate, by Sarstedt (1 mentions)
Cck 8 reagent, by Meilun (1 mentions)
48 protocols using cytation 5 reader
1
Mitochondrial Calcium Quantification Protocols
2
Isolation and Analysis of Human Leukocytes and Neutrophils
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human whole leukocytes were isolated by lysing erythrocytes with ammonium-chloride-potassium lysis buffer (Gibco). Human neutrophils were isolated by density gradient centrifugation using the Polymorphprep kit according to the manufacturer’s instructions (Axis-Shied). Cells were subsequently washed with phosphate-buffered saline (PBS) and resuspended in phenol red-free RPMI 1640 medium supplemented with 2% fetal bovine serum (Gibco). For cytotoxicity assays, whole leukocytes were dispensed at 2 × 105 cells/well in a final volume of 100 μl/well in a 96-well plate. Exoprotein samples described above were added to the cells and incubated for up to 1 h at 37°C. PI (10 μg/ml) was added, and the cells were further incubated for 15 min. The cytotoxicity was measured by the fluorescence signal at 590 nm using a NovoCyte flow cytometer (Agilent Technologies) and a Cytation 5 reader (BioTek). For Transwell experiments, human HEp2 cells were cultured in 24-well plates to 80% confluence. A 0.45-μm Transwell insert (Corning) containing human neutrophils at 1 × 105 cells/well was placed in the 24-well plate. In some experiments, LukF and LukS (1 μg of each; IBT Bioservices) were added to the Transwells and incubated for up to 12 h. The cytotoxicity was monitored using a Cytation 5 reader (BioTek).
3
Cathepsin B Activity Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cath B activity was measured using a fluorometric Cathepsin B Activity Assay Kit (Abcam, Berlin, Germany). All cells (1 × 105/well) were seeded in 6-well plates (Sarstedt) and treated with increasing concentrations of nivolumab the following day. After 24 h of incubation, the cells were harvested, washed in PBS (Sigma) and resuspended in chilled Cell Lysis Buffer (4 °C), which was included in the kit, for 30 min, followed by centrifugation at 4 °C for 5 min. The activity was measured in the supernatant according to the manufacturer’s instructions. The output was measured using a Cytation5 reader (Agilent Technologies) at Ex/Em = 400/505 nm.
4
3D Spheroid Culture with Nivolumab
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3D culture was initiated using 1 × 104 cells/well in a nonadherent round-bottom 96-well plate (Sarstedt). The control medium and medium enriched with nivolumab were changed every 4–5 days. Spheroid formation was observed for 6 weeks. Images and spheroid measurements were performed using a Cytation5 reader (Agilent Technologies). The aggregates were considered spheroids if they displayed visible 3D structures.
5
Cell Viability Assay with CCK-8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MKN45, SNU‐638, and SNU‐1 cells were seeded into 96‐well plates at the density of 5 × 104 cells/ml overnight and were exposed to drugs. At the end of treatment, CCK‐8 reagent (#MA0218; MeilunBio) was added and the cell viability was determined using the Cytation 5 Reader (Agilent BioTek).
6
Quantification of FXN Gene Expansions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from cells was isolated using the QIAamp DNA Mini and Blood Mini kit (51104, Qiagen). DNA concentration and purity were determined with the Cytation 5 reader (Agilent Technologies).
Amplification of GAA repeat expansions in the FXN gene was performed by PCR using primers GAA_F: 5′‐GGCTTGAACTTCCCACACGTGTT and GAA_R: 5′‐A GGACCATCATGGCCACACTT, as previously described (Long et al., 2017 (link)). Reactions utilized the Failsafe PCR System with mix D (FS99100). The thermal cycler was programmed as follows: 94°C for 3 min, 20 cycles of 94°C for 20 s, 64°C for 30 s, and 68°C for 5 min, followed by 9 cycles of 94°C for 20 s, and 68° for 5 min, each subsequent elongation step increased by 15 s. The last step was 68°C for 7 min. The amplification products were resolved on 1% agarose gels stained with SYBR Safe DNA Gel Stain (cat. S33102, Thermo Fisher). The length of an expanded GAA repeat was determined using the base pair size called function, of Image Lab 6.0 (BioRad). The GAA length was calculated by subtracting the length of the PCR primers and GAA flanking sequences from the number of base pairs of the PCR product and dividing the difference by three. [Number of GAA repeats = (length of base pairs of a PCR product−498)/3]The reference sequence used is NG_008845.2.
Amplification of GAA repeat expansions in the FXN gene was performed by PCR using primers GAA_F: 5′‐GGCTTGAACTTCCCACACGTGTT and GAA_R: 5′‐A GGACCATCATGGCCACACTT, as previously described (Long et al., 2017 (link)). Reactions utilized the Failsafe PCR System with mix D (FS99100). The thermal cycler was programmed as follows: 94°C for 3 min, 20 cycles of 94°C for 20 s, 64°C for 30 s, and 68°C for 5 min, followed by 9 cycles of 94°C for 20 s, and 68° for 5 min, each subsequent elongation step increased by 15 s. The last step was 68°C for 7 min. The amplification products were resolved on 1% agarose gels stained with SYBR Safe DNA Gel Stain (cat. S33102, Thermo Fisher). The length of an expanded GAA repeat was determined using the base pair size called function, of Image Lab 6.0 (BioRad). The GAA length was calculated by subtracting the length of the PCR primers and GAA flanking sequences from the number of base pairs of the PCR product and dividing the difference by three. [Number of GAA repeats = (length of base pairs of a PCR product−498)/3]The reference sequence used is NG_008845.2.
7
DHFR Enzyme Inhibition Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human purified DHFR was purchased from R&D Systems (8456-DR). DHFR activity was assayed by monitoring the decrease in absorbance by NADPH at 340 nM. DHFR enzyme (0.5 µg ml−1), dihydrofolic acid (100 µM) and different concentrations of methotrexate, fluorofolin or DMSO control were dissolved in 200 µl of Tris buffer (pH 7.5, Tris salt concentration 25 mM). Reaction was initiated by adding NADPH in a 10× stock (1 mM for a final concentration of 100 µM), and absorbance at 340 nM was monitored over time using a Cytation 5 reader (Agilent). Activity was normalized to the DMSO control.
8
Frataxin Expression Cytotoxicity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine whether forced expression of frataxin resulted in cell toxicity we used the Cell Counting Kit‐8 (CCK8) (96992, Sigma‐Aldrich). 5000 cells/well (iNs and iCMs) were seeded in a 96‐well plate. Cells were transduced with frataxin lentivirus, and 2 weeks later, the cytotoxicity assay was performed. 10 μl of the CCK8 solution was added to each well of the plate containing transduced, non‐transduced cells, and control without cells. After 2 h of incubation at 37°C, the absorbance was measured at 450 nm using the Cytation 5 reader (Agilent Technologies). This assay was repeated three times, using a minimum of 6 wells per condition each time.
9
Wound Healing Assay with GO and FLG
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wound healing
assay was carried
out by the protocol set up previously.15 (link) HaCaT cells were incubated with GO 1, GO 2, or FLG for 30 days.
After each treatment, cells were plated in 24-well plates, cultured
to confluence, and then serum-starved for 12 h. A cross-scratch was
done in the monolayer with a 200 μL pipette tip, and a fresh
medium replaced the medium. Images were acquired on a Cytation 5 Reader
(BioTek) using a 4× objective. The percentage of wound closure
was calculated by measuring the open area free of cells for each image,
using ImageJ, immediately after making the scratch and 48 h after
treatment. The results shown are an average of n =
3.
assay was carried
out by the protocol set up previously.15 (link) HaCaT cells were incubated with GO 1, GO 2, or FLG for 30 days.
After each treatment, cells were plated in 24-well plates, cultured
to confluence, and then serum-starved for 12 h. A cross-scratch was
done in the monolayer with a 200 μL pipette tip, and a fresh
medium replaced the medium. Images were acquired on a Cytation 5 Reader
(BioTek) using a 4× objective. The percentage of wound closure
was calculated by measuring the open area free of cells for each image,
using ImageJ, immediately after making the scratch and 48 h after
treatment. The results shown are an average of n =
3.
10
Quantifying Cell Proliferation by Ki-67 Immunostaining
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ki-67 positive cells were determined by immunocytochemistry with a specific monoclonal antibody (#sc-15402, SantaCruz BT). Briefly, cells treated for 30 d were seeded in 96 well plates. Medium was removed and cells were fixed for 2 min in cold methanol, blocked and incubated for 60 min with anti-Ki67 antibody (1:500). The cells were then stained with an AlexaFluor-594 anti-mouse (#A-11005, Invitrogen) for 60 min and stained with 1 μg/mL Hoescht (#861405; Sigma-Aldrich). Images were acquired in a Cytation 5 Reader (Biotek) using a 20 × objective and analyzed with ImageJ 1.53.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!