Log In Sign up
The largest database of trusted experimental protocols

Prl tk renilla reporter plasmid

Manufactured by Promega
Visit Supplier
Sourced in United States

The PRL-TK Renilla reporter plasmid is a laboratory tool that can be used to measure Renilla luciferase activity. Renilla luciferase is a bioluminescent protein that emits light when catalyzed by its substrate. The PRL-TK plasmid contains the Renilla luciferase gene under the control of a promoter, allowing for the expression and detection of Renilla luciferase in various experimental systems.

Automatically generated - may contain errors

Lab products found in correlation

Dual luciferase reporter assay system, by Promega (5 mentions) Glomax multi detection system, by Promega (3 mentions) Dual luciferase assay system, by Promega (2 mentions) Dual luciferase system, by Promega (2 mentions) Neon kit, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Pgl4 basic luciferase reporter vector, by Promega (2 mentions) Pgl3 basic reporter vector, by Promega (2 mentions) Dual glo luciferase assay system, by Promega (2 mentions) Fugene 6 transfection reagent, by Roche (1 mentions) Nucleofector 1 device, by Lonza (1 mentions) Vpa 1009, by Lonza (1 mentions) Pmirglo dual luciferase mirna target expression vector, by Promega (1 mentions) Nucleofector kit 5, by Lonza (1 mentions) Pgl3 basic luciferase reporter vector, by Promega (1 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter assay kit, by Promega (1 mentions)

13 protocols using prl tk renilla reporter plasmid

1

Nur77 Regulation of SDF-1α Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RAW264.7 cells were transiently transfected with wild-type or mutant SDF-1α luciferase reporter plasmids together with pCMV-Myc-Nur77 or pCMV-mock. pRL-TK Renilla reporter plasmid (Promega) was co-transfected as an internal control. Luciferase activity measurements were performed using the dual-luciferase reporter assay system (Promega) and Glomax Multi detection system (Promega) according to the manufacturer’s instructions. Each experiment (in duplicate) was repeated at least three times.
Hamers A.A., Argmann C., Moerland P.D., Koenis D.S., Marinković G., Sokolović M., de Vos A.F., de Vries C.J, & van Tiel C.M. (2016). Nur77-deficiency in bone marrow-derived macrophages modulates inflammatory responses, extracellular matrix homeostasis, phagocytosis and tolerance. BMC Genomics, 17, 162.
+ Open protocol
+ Expand
2

Transfection and Luciferase Assay for Cyclin D1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transient transfection and reporter assays were carried out in serum starved SMCs with the indicated reporter plasmids using Fugene6 transfection reagent (Roche) according to the manufacturer's protocol. The level of promoter activity was evaluated by measurement of firefly luciferase activity. pRL-TK Renilla reporter plasmid (Promega) was co-transfected as an internal control. Luciferase activity was measured by using the Dual Luciferase Assay System and Glomax Multi detection system as described by the manufacturer (Promega). pGL3-CyclinD1 reporter vector was a kind gift from Dr. J J Molenaar (Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands) and has been described [22] (link). To increase basal CyclinD1, serum-starved SMCs were stimulated with FCS. Cells were pre-treated overnight with PD98059 at a final concentration of 25 µM. A minimum of three independent transfections were performed and all assays were repeated at least three times.
Kurakula K., Vos M., Otermin Rubio I., Marinković G., Buettner R., Heukamp L.C., Stap J., de Waard V., van Tiel C.M, & de Vries C.J. (2014). The LIM-Only Protein FHL2 Reduces Vascular Lesion Formation Involving Inhibition of Proliferation and Migration of Smooth Muscle Cells. PLoS ONE, 9(4), e94931.
+ Open protocol
+ Expand
3

Stat1 3' UTR Luciferase Assay

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
pmirGLO dual-luciferase miRNA target expression vector was purchased from Promega. Wild-type, mutant 1, mutant 2 or mutant 1 and mutant 2 3′ UTR of Stat1 gene fragments were synthesized by Twist Bioscience and cloned into the pmirGLO vector. Ythdf2f/f and Ythdf2cKO BMDMs were transfected with the pmirGLO reporter plasmids using a mouse macrophage nucleofector kit (VPA-1009, Lonza) with program Y-001 on a Nucleofector I device (Amaxa). The cells were collected for lysis 24 h after transfection. The mouse pGL4-Ythdf2 reporter plasmid was generated as previously described51 (link). Mouse Stat3 pcDNA3 plasmid was purchased from Addgene (8706). BMDMs were cotransfected with the pGL4-Ythdf2 reporter plasmid and Stat3 overexpression plasmids or an empty vector together with a pRL-TK Renilla reporter plasmid (Promega) for normalization of transfection efficiency. The cells were collected for lysis 24 h after transfection. Luciferase activity was quantified fluorimetrically with the dual-luciferase system (Promega).
Finocchiaro G., Taroni F., Rocchi M., Martin A.L., Colombo I., Tarelli G.T, & DiDonato S. (1991). cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase.. Proceedings of the National Academy of Sciences of the United States of America, 88(2), 661-665.
+ Open protocol
+ Expand
4

Transfection and Luciferase Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Non-treated or treated bovine cells were transfected with the cyclinD1 or BIC Luciferase reporters, using electroporation (Neon kit, Invitrogen, Ref: MPK1096). Mouse cells were transfected using Lipofectamine 2000 (Invitrogen, Ref: 11668019). Transfection efficiencies were normalized to Renilla activity by co-transfection of a pRL-TK Renilla reporter plasmid (Promega, Ref: E6241). Luciferase assays were performed 36h post-transfection using the Dual-Luciferase Reporter Assay System (Promega, Ref: E1980) in a microplate luminometer. Relative luminescence was represented as the ratio Firefly/Renilla luminescence, compared with the corresponding empty vector control.
Marsolier J., Perichon M., DeBarry J., Villoutreix B., Chluba J., Lopez T., Garrido C., Zhou X., Lu K., Fritsch L., Ait-Si-Ali S., Mhadhbi M., Medjkane S, & Weitzman J. (2015). Theileria parasites secrete a prolyl isomerase to maintain host leukocyte transformation. Nature, 520(7547), 378-382.
+ Open protocol
+ Expand
5

Cloning and Analyzing PDGFRB, PDGFD Promoters

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The promoter regions of PDGFRB and PDGFD were amplified and cloned into the pGL4-basic luciferase reporter vector (Promega). HEK293T cells purchased from ATCC were cotransfected with the pGL4-PDGFRB or pGL4-PDGFD reporter plasmid as well as with a p65-overexpression plasmid or empty vector. A pRL-TK Renilla reporter plasmid (Promega) was added to normalize transfection efficiency. The cells were harvested for lysis 24 h after transfection, and luciferase activity was quantified fluorimetrically with Dual-Luciferase Reporter Assay System (Promega). A p65 overexpression plasmid was used as previously described (33 (link)). Primer sequences for cloning the PDGFRB and PDGFD promoters were as follows: PDGFRB forward, 5′- CGGGGTACCCAAAGACCTGGCCAGGCCCCCTCT-3′; PDGFRB reverse, 5′-CCGCTCGAGCTGGCAGCCTCAGGAGCTCACACCA-3′; PDGFD forward, 5′- CCGCTCGAGCAAAGAGATTAGGAACTTTATTTCT-3′; and PDGFD reverse, 5′- CCCAAGCTTTGACGGGACAAACAACAGGTTGA -3′.
Ma S., Tang T., Wu X., Mansour A.G., Lu T., Zhang J., Wang L.S., Caligiuri M.A, & Yu J. (2022). PDGF-D−PDGFRβ signaling enhances IL-15–mediated human natural killer cell survival. Proceedings of the National Academy of Sciences of the United States of America, 119(3), e2114134119.
+ Open protocol
+ Expand
6

IGF-2 Promoter Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
pGL3-IGF-2 promoter reporter plasmids (P3) were kindly provided by Dr P. Elly Holthuizen (Utrecht University, Utrecth, The Netherlands). IGF-2 promoter 4 region was inserted into the XhoI–HindIII restriction site of the pGL3 basic reporter vector (Promega). pRL-Tk Renilla reporter plasmid was purchased from Promega. Cells pretreated with cixutumumab for 6 days were seeded into 24 wells and then transfected with each reporter vectors and pRL-Tk vectors. Forty-eight hours after transfection, luciferase activity was measured using Dual-Glo Luciferase Assay System (Promega). Transfection efficiency was determined by normalizing the reporter activity with Renilla luciferase activity.
Lee J.S., Kang J.H., Boo H.J., Hwang S.J., Hong S., Lee S.C., Park Y.J., Chung T.M., Youn H., Mi Lee S., Jae Kim B., Chung J.K., Chung Y., William WN J.r., Kee Shin Y., Lee H.J., Oh S.H, & Lee H.Y. (2015). STAT3-mediated IGF-2 secretion in the tumour microenvironment elicits innate resistance to anti-IGF-1R antibody. Nature Communications, 6, 8499.
+ Open protocol
+ Expand
7

Cotransfection of Jurkat and Raji Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Harvested cells were suspended in each culture medium supplemented with additional 10% fetal calf serum (FCS). Jurkat cells and Raji cells (2 × 105 cells in 0.5 mL) were cotransfected with 5 μg of the test construct and 25 ng of the pRL-TK Renilla reporter plasmid (Promega) using Nucleofector Kit V(LONZA) according to the manufacturer’s protocol. On the coexpression analysis, 3 μg of pCMV-YY1 or control pCMV6-XL5 was added into the cell suspension. The luciferase activity was measured, as described previously[22 (link)].
Sun W., Wu H.Y, & Chen S. (2017). Influence of TBX21 T-1993C variant on autoimmune hepatitis development by Yin-Yang 1 binding. World Journal of Gastroenterology, 23(48), 8500-8511.
+ Open protocol
+ Expand
8

PHLDA1 Gene Promoter Activity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The PHLDA1 gene promoter sequence from -2148 bp to +239 bp of the transcription start site was amplified from human leukocytes and cloned into the pGL3-basic luciferase reporter vector (Promega) to generate pGL3-PHLDA1. 2008 cells were transfected with either the empty vector or pGL3-PHLDA1 together with pRL-TK Renilla reporter plasmid (Promega) to normalize transfection efficiency. Cells were incubated for 48 h and then treated with 0.2 mM H2O2 for an additional 4 h. Luciferase activity was then quantified fluorometrically using the Dual Luciferase Assay system (Promega).
Xu J., Bi G., Luo Q., Liu Y., Liu T., Li L., Zeng Q., Wang Q., Wang Y., Yu J, & Yi P. (2021). PHLDA1 Modulates the Endoplasmic Reticulum Stress Response and is required for Resistance to Oxidative Stress-induced Cell Death in Human Ovarian Cancer Cells. Journal of Cancer, 12(18), 5486-5493.
+ Open protocol
+ Expand
9

Transient Transfection of NFκB Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transiently transfected with a NFκB reporter plasmid and a NFκB subunit p65 reporter plasmid using Lipofectamine LTX plus transfection reagent according to the manufacturer’s protocol and assay was described previously [25 (link)]. The construct containing the NFκB response element of the minimal IL-6 promoter was kindly provided by Dr. Karolien De Bosscher (Ghent University, Belgium) and was described previously [26 (link)]. The pRL-TK Renilla reporter plasmid (Promega) was co-transfected as an internal control for transfection efficiency. Luciferase activity measurements were performed using the dual-luciferase reporter assay system (Promega) and Glomax multi detection system (Promega) according to the manufacturer’s protocol. Each experiment (in duplicate) was repeated at least three times.
Kurakula K., Hamers A.A., van Loenen P, & de Vries C.J. (2015). 6-Mercaptopurine reduces cytokine and Muc5ac expression involving inhibition of NFκB activation in airway epithelial cells. Respiratory Research, 16(1), 73.
+ Open protocol
+ Expand
10

Transfection and Luciferase Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Non-treated or treated bovine cells were transfected with the cyclinD1 or BIC Luciferase reporters, using electroporation (Neon kit, Invitrogen, Ref: MPK1096). Mouse cells were transfected using Lipofectamine 2000 (Invitrogen, Ref: 11668019). Transfection efficiencies were normalized to Renilla activity by co-transfection of a pRL-TK Renilla reporter plasmid (Promega, Ref: E6241). Luciferase assays were performed 36h post-transfection using the Dual-Luciferase Reporter Assay System (Promega, Ref: E1980) in a microplate luminometer. Relative luminescence was represented as the ratio Firefly/Renilla luminescence, compared with the corresponding empty vector control.
Marsolier J., Perichon M., DeBarry J., Villoutreix B., Chluba J., Lopez T., Garrido C., Zhou X., Lu K., Fritsch L., Ait-Si-Ali S., Mhadhbi M., Medjkane S, & Weitzman J. (2015). Theileria parasites secrete a prolyl isomerase to maintain host leukocyte transformation. Nature, 520(7547), 378-382.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!