Sybr premix ex taq 2

To determine the Pv5-HT₇ receptor expression pattern in different developmental stages and castes, we isolated total RNA from eggs (5 d), first to fourth larvae (5 d), pupae (5 d), and adults (winged females, winged males, and workers). Samples were selected from three colonies. Each sample was run in triplicate along with the internal control gene β-actin. The primers and probe sequences are listed in Table 1. qRT-PCR was performed using a Biorad system in a total volume of 25 µL, containing 12.5 µL of SYBR Premix Ex Taq II, 1 µL of PCR each primer (10 µM), 1 µL of cDNA template, and 9.5 µL of sterile water. The reaction procedure was as follows: denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. A dissociation curve analysis (from 65 to 90°C with increments of 0.5°C every 15 s) was conducted to ensure that only one PCR product was amplified and detected. The standard curve was obtained by the determining Ct (cycle threshold) values of a series of 10-fold diluted samples. The slope of the standard curve and the PCR efficiency of the genes were calculated. A negative control was carried out using sterile water instead of cDNA template. The relative expression value was calculated using the 2^-∆∆Ct method.

Total RNA was extracted from cells using TRIzol Reagent (Invitrogen) following the manufacturer's instructions. First‐strand cDNA synthesis and amplification were performed using PrimeScript™ RT reagent kit with gDNA Eraser (TaKaRa). Q‐PCR was used to quantify the expression of Gli3, PTCH1, Bmi‐1, mRNAs using SYBR^® Premix Ex TaqII (Bio‐Rad). The primers for q‐PCR are listed below: Gli3, forward 5′‐ACTTCCGCCTTATCTAGTAGCC‐3′, reverse 5′‐CCACGGGTTGCTGAGATCAT‐3′; PTCH1, forward 5′‐GAAGAAG‐ GTGCTAATGTCCTGAC‐3′, reverse 5′‐GTCCCAGACTGTAATTTCGCC‐3′; Bmi‐1, forward 5′‐GGATCCTCATCCTTCTGCTGATGCTG‐3′, reverse 5′‐GAATTCGCATCACAGTCATTGCTGCT‐3′.

TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total RNA from the cell lines and tissue samples, following the manufacturer's protocol. The RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) was used to convert the RNA into cDNA with the following temperature protocol: 25°C for 5 min, followed by 42°C for 60 min and 70°C for 5 min. The following primers were used for qPCR: RASSF1A forward, 5′-AGTGCGCGCATTGCAAGTT-3′ and reverse, 5′-AAGGTCAGGTGTCTCCCAC-3′; miR-181a forward, 5′-ACACTCCAGCTGGGAACATTCAACGCTGTCG-3′ and reverse, 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGACTCACCG-3; RNU6B forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′. The primers of miR-181a and RNU6B were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). For the chain reaction, 2 µl of cDNA, 1 µl forward primer and 1 µl reverse primer were mixed in SYBR Premix Ex Taq II (Takara Biotechnology Co., Ltd., Dalian, China) reagent. RT-qPCR was performed with a CFX96™ Real-Time PCR Detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using SYBR Premix Ex Taq II at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 1 min. The specific mRNA expression level was quantified by using the 2^−∆∆Cq method (20 (link)). Each experiment was repeated three times.