Pgem vector

equinox was cloned using the following primers: fwd: 5′ gggccagttacttcacaagc; rv: 5′ gagccagagaaagattgcgg; bmp4 (dd_Smed_v6_17402_0_1) accession number: GenBank ABV04322.1. All constructs were cloned from cDNA into the pGEM vector (Promega). These constructs were used to synthesize RNA probes and dsRNA for RNAi experiments.

Zooxanthellae DNA was extracted using a protocol described by Nir [23] , followed by PCR amplification of the ITS-2 region with the primers “ITSintfor2” (5′GAATTGCAGA ACTCCGTG-3′) and “ITS2CLAMP” (5′ GGGATCCATATGCTTAAGT TCAGCGGGT-3′) [24] . PCR products were cleaned (Wizard SV Gel and PCR Clean-Up System, Promega), and ligated into the pGEM vector (Promega, Madison, WI). The plasmids were inserted into competent Escherichia coli cells (strain DH5) and cultured on Fast Media Lab Agar IPTG/X Gel plates (Fermentas, Vilnius, Lithuania). We sequenced the ITS2 rRNA gene (337 bp) from 23 deep colonies (6–10 clones/colony, totaling 172 sequences) and 5 shallow colonies (9–10 clones/colony, totaling 49 sequences) (HyLabs, Israel). Sequences were viewed and analyzed with BioEdit software.

Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech) and sense (CGCGAATTCATGAAGTGGGTAACC) and antisense (CGCCTCGAGTTATAAGCCTAAGGCAGC) primers containing EcoRI and XhoI restriction sites (underlined), respectively. The amplified product was cloned into a pGEM vector (Promega), sequenced and subcloned into pPICZA vector (Invitrogen). The propeptide sequence (AGGGGTGTGTTTCGTCGA) was deleted by PCR using primers flanking the target sequence (reverse GGAATAAGCCGAGCTAAAGAGAAAAAGAAGGG and forward GATGCACACAAGAGTGAGGTTGCTCATCGG) previously phosphorylated with T4 polynucleotide kinase T4-PNK (Thermo Scientific). T4 ligase (Thermo Scientific) was used to blunt end ligate the PCR product. Domain I (DomI) coding region was obtained from the last by PCR amplification using KAPA HiFi polymerase (Kapa Biosystems) and specific sense (CGCGAATTCATGAAGTGGGTAACC) and antisense (CGCCTCGAGTTATTTGGCAGACGAAGCCTT) primers containing EcoRI and XhoI restriction sites (underlined), respectively. Then it was subcloned back into pPICZA (pPICZA-DomI).

titin-like (forward primer 5′GTTGGCTTGGCGGAAGTA-3′; reverse primer 5-′ATCTCAAGCGGGACCACA-3′) and ho.98018390 (forward primer 5′CGCTGTTGTCCAGACGATT-3′; reverse primer 5′TCTTGGTCTGCCCCAACT3′) were cloned from cDNA into the pGEM vector (Promega). titin-like was annotated by best BLAST hit.