Superscrip vilo cdna synthesis kit

Extractions of RNA were performed after cells were collected utilizing the GenElute Total RNA Purification Kit (Sigma‐Aldrich; Merck KGaA). Reverse transcription of total RNA (2.0 μg) was performed with SuperScrip®Vilo cDNA synthesis kit (Invitrogen). The comparative overexpression of SNHG15, miR‐153‐3p, and ATG5 were determined employing qPCR with a SYBR green I Master Mix kit (Invitrogen; Thermo Fisher Scientific, Inc.) in a 7500 real‐time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The methods followed what was laid forth in the kit's manual. U6 was the intrinsic control of miR‐153‐3p. GAPDH was the intrinsic control of SNHG15 and ATG5. The following cycling procedure was used for qRT‐PCR: initial denaturation, 95°C, 10 min; 95°C, 20 s, 60°C, 15 s and 72°C, 20 s; 40 cycles. Expression was quantified using the formula 2 −ΔΔCq. Primer sequences: SNHG15:Forward primer: 5′‐CAACCATAGCGGTGCAACTGTGC‐3′, Reverse primer: 3′‐GGCTGAACCAAGTTGCAAGTCATG‐5; miR‐153‐3p:Forward primer: 5‐GTCAATTGAGCACGTGGC‐ CAC‐3; Reverse primer:5‐GACGTACGGACTGACGGACCAC3; ATG5:Forward primer: CACCGAGTGGATAATCTTTATGGCA Reverse primer:AAACTGCCATAAAGATTATCCACTC; U6:Forward primer:GGAAGTAGCACCTGATTAGC Reverse primer:TTGGAATACGAATIGGCCG; GAPDH:Forward primer:CTCACCGGATGCACCAATGTT Reverse primer:CGCGTTGCTCACAATGTTCAT.