Rnase and dnase free water

Genomic DNA was extracted in a QIAcube instrument following the manufacturer’s standard protocol for saliva nucleic acid extraction (QIAGEN, Valencia, CA). After isolation, allelic discrimination for the FTO gene was determined via real-time polymerase chain reaction (PCR) using a TaqMan SNP genotyping assay using fluorogenic probes (Applied Biosystems, CA) with the primer sequence TAGCAGTTCAGGTCCTAAGGCATGA[C/T]ATTGATTAAGTGTCTGATGAGAATT. Thermal cycling was performed on StepOne Real-Time PCR system (Applied Biosystems, CA). The amplification mix contained the following ingredients: 12.5 μL of PCR master mix (QIAGEN, Valencia, CA), 1.25 μL of TaqMan 20X working stock, 10.25 μL of RNase- and DNase-free water (Sigma), and 1.0 μL of sample DNA, in a total volume of 25 μL per single tube reaction. The PCR conditions were 95 °C for 10 min followed by 40 repeated cycles of 95 °C for 15 s and 60 °C for 60 s. Aliquots corresponding to the products from the first round of amplification were used as templates for a second round of amplification (30 cycles, with the same conditions). Genotypes were determined automatically via the StepOne software (Applied Biosystems, CA) based on the fluorescence signals. Samples were run in duplicate and in the case of a call discrepancy, samples were rerun.

Each qPCR reaction contained a volume of 25 μL and consisted of 12.5 μL 2× SYBR Green JumpStart Taq Ready Mix (Thermo-Fisher Scientific, Waltham, MA, USA), 1 μL each of the forward and reverse primers (10 μM final working concentration, Table 2), 0.5 μL of RNase and DNase free water (Sigma-Aldrich), and 10 μL of cDNA (concentration depended on the specific analysis). A C1000 Touch thermal cycler with CFX96 Real-Time System (Bio-Rad, Oslo, Norway) was used for qPCR, with the following cycle conditions: 94 °C for 5 min followed by 40 cycles of 94 °C for 15 s and 60 °C for 1 min. Melting curve analyses were performed after each run (60 to 92 °C at a rate of 1 °C/5 s) to ensure that the specificity of the primers and the qPCR products were visualized on a 2% agarose gel. Three parallel reactions were performed for each gene, and negative controls excluding cDNA (NTC) and cDNA reactions without reverse transcriptase (NRT) were included for all master mixes. The gene expression levels were calculated by the ΔΔCt method [65 (link)].

For RT-PCR, a monolayer of CoO 0%, 2% and Synthemax II microspheres was placed in
24 ultra-low attachment plates (Costar^®) and UV sterilised for 1 h
30 min. hMSCs were seeded at a density of 30,000 cells/well. The following time
point were analysed: day 4, 7 and 14. Three independent experiments were
performed using three different hMSCs donors.
RNA isolation and cDNA synthesis Total RNA was isolated using an RNeasy Mini Kit
with on-column DNase treatment (QIAGEN VWR) according to the protocol given by
the manufacturer. The concentration and purity of RNA was determined by using a
NanoDrop spectrophotometer (NanoDrop Technologies). cDNA was synthesised from
100 ng of RNA using SuperScript III First-Strand Synthesis SuperMix (Invitrogen,
Life Technologies) in a total volume of 21 μL, as per manufacturer’s
instructions. An equivalent volume of DNase and RNase-free water (Sigma) was
used in place of RT Enzyme Mix for no-RT controls.