Yeast Transformation Kit, 2,6-dimethoxyphenol (DMP), N,N-dimethyl-1,4-phenylenediamine (DMPD), 5-Hydroxyimino-2,4,6(1H,3H,5H)-pyrimidinetrione (violuric acid), Evans Blue (EB), Reactive Black 5 (RB5), aniline, p-phenylenediamine (PPD) and HBT were purchased from Sigma-Aldrich (St. Louis, MI, USA). High Pure Plasmid Isolation Kit and 2,2′azinobis (3 ethylbenzothiazoline-6 sulphonic acid) (ABTS) were obtained from ROCHE (Basel, Switzerland). Detergents: polyoxyethylene (10) tridecyl (PET), TWEEN 20 and CHAPS were purchased from Sigma-Aldrich (St. Louis, MI, USA). Phusion High-Fidelity DNA polymerase and Restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA). QIAquick gel extraction kit from Qiagen (Hilden, Germany). ZymoprepTM Yeast Plasmid Miniprep II was purchased from Zymo Research (Irvine, CA, USA). S. cerevisiae BJ5465 strain was purchased from LGC Promochem (Teddington, UK) and Mutazyme II DNA polymerase was from Agilent (Santa Clara, CA, USA). Agrocybe pediades AH40210 was obtained from the University of Alcalá Herbarium Culture Collection, Alcalá de Henares, Spain.
Mutazyme 2 dna polymerase
Manufactured by Agilent Technologies
Sourced in United Kingdom, United States
Mutazyme II DNA polymerase is a high-fidelity DNA polymerase enzyme used for PCR amplification. It possesses 3'->5' exonuclease proofreading activity to improve the accuracy of DNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
P phenylenediamine ppd, by Merck Group (1 mentions)
2 2 azinobis 3 ethylbenzothiazoline 6 sulphonic acid, by Roche (1 mentions)
Phusion high fidelity dna polymerase and restriction enzymes, by New England Biolabs (1 mentions)
High pure plasmid isolation kit, by Roche (1 mentions)
S cerevisiae bj5465 strain, by LGC (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
Chaps, by Merck Group (1 mentions)
Yeast transformation kit, by Merck Group (1 mentions)
Xl1 blue competent cells, by Agilent Technologies (1 mentions)
Genemorph 2 random mutagenesis kit, by Agilent Technologies (1 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Phusion polymerase, by New England Biolabs (1 mentions)
6 protocols using mutazyme 2 dna polymerase
1
Yeast Transformation and Enzyme Assay
2
Directed Evolution of SaFabI Enzyme
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Error-prone PCR
(epPCR) techniques25 (link),26 (link) were used to randomly introduce
mutations to the WT SaFabI gene,28 (link) using a commercially available kit with Mutazyme II DNA
polymerase (GeneMorph II, Agilent Technology; Santa Clara, CA) and
a thermal cycler (Eppendorf AG 22331; Hamburg, Germany). To first
determine the number of cycles needed to introduce a sufficient number
of mutations in the SaFabI gene, the amount of amplified
DNA in each doubling cycle was monitored by gel electrophoresis for
epPCR products obtained from various numbers of cycles. Their gel
intensities were obtained from a calibration curve constructed with
the intensities on gels of known amounts of WT SaFabI gene. Based on the results and the GeneMorph II kit instruction,
the epPCR with 25 cycles was used, with 100 ng templates, to give
a medium mutation frequency (one to six mutations per individual gene)
and 10 μg product.
The epPCR product (mutated SaFabI genes) was ligated to a pET-15b plasmid, an expression
vector consisting of a hexa-histidine segment at the N-terminal end
to give pET-15b-SaFabI mutant plasmids. These plasmids
were transformed into DH5α Z-Competent E. coli cells (Zymo; Irvine, CA), and the mixture was plated on ampicillin
containing agar plates. Individual colonies were harvested and labeled.
Each colony was prepared and stored as freeze-down samples.
(epPCR) techniques25 (link),26 (link) were used to randomly introduce
mutations to the WT SaFabI gene,28 (link) using a commercially available kit with Mutazyme II DNA
polymerase (GeneMorph II, Agilent Technology; Santa Clara, CA) and
a thermal cycler (Eppendorf AG 22331; Hamburg, Germany). To first
determine the number of cycles needed to introduce a sufficient number
of mutations in the SaFabI gene, the amount of amplified
DNA in each doubling cycle was monitored by gel electrophoresis for
epPCR products obtained from various numbers of cycles. Their gel
intensities were obtained from a calibration curve constructed with
the intensities on gels of known amounts of WT SaFabI gene. Based on the results and the GeneMorph II kit instruction,
the epPCR with 25 cycles was used, with 100 ng templates, to give
a medium mutation frequency (one to six mutations per individual gene)
and 10 μg product.
The epPCR product (mutated SaFabI genes) was ligated to a pET-15b plasmid, an expression
vector consisting of a hexa-histidine segment at the N-terminal end
to give pET-15b-SaFabI mutant plasmids. These plasmids
were transformed into DH5α Z-Competent E. coli cells (Zymo; Irvine, CA), and the mixture was plated on ampicillin
containing agar plates. Individual colonies were harvested and labeled.
Each colony was prepared and stored as freeze-down samples.
3
Random Mutagenesis of Influenza Virus
4
Directed Evolution of CYP2C8 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frame region of CYP2C8 (1.5 kb) was randomly mutated and amplified using Mutazyme™ II DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions, with the forward primer 5′-GCGAGGTCATATGGCTCTG-3′ and the reverse primer 5′-CCCTGGTTCTAGACTAATGG-3′. The amplified PCR products were purified and cloned into the pCW bicistronic vector using the NdeI and XbaI restriction enzyme sites. The ligated library plasmid was transformed into E. coli DH10b ultracompetent cells (Life Technologies, Carlsbad, CA, USA) and subsequently amplified.
5
Generation and Screening of Tim50 Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A library of random Tim50 mutants was generated through error prone PCR on the sequence of mature Tim50, using MutazymeII DNA polymerase (Agilent technologies) according to the manufacturer’s instructions. The reaction was carried out with forward primer 5′ GGATCCCAAAAAGAAACAAAAGACGAC3′, and reverse primer 5′AAGCTTTTATTT GGATTCAGCAATCTTC3′ on 300 ng target DNA (total reaction volume 50 μl). The resulting PCR products were digested with BamHI and HindIII and were ligated into the pRS315 vector described above. The Tim50 plasmid shuffling strain described above was transformed with the library. Transformants were patched on an SCD plate lacking uracil and leucine and were then replica plated on medium containing 5-fluoroorotic acid (5-FOA) to select for colonies that express only Tim50 encoded by pRS315 and have lost the URA plasmid. In order to find temperature sensitive mutants, the 5-FOA plates were replica plated on two SCD (-Leu) plates, one for the examination of growth at 30 °C and the other at 37 °C. Colonies exhibiting temperature sensitive growth were isolated and the coding region of Tim50 was sequenced.
6
Error-prone PCR Mutagenesis of RNA Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA expression vector (pDRNL43 NotI ATGaag NgoMIV Tat(–) ΔEnv) was mutated by error-prone PCR using the Mutazyme II DNA polymerase (Agilent) and the primers NL43_NotI_Fw and NgoMIV_Rv (Supplementary Table S1 ). We chose Mutazyme II as it is reported to produce a more uniform mutational spectrum than traditional error-prone PCR. The PCR reaction volume was 50 μl and consisted of 100 ng of template DNA, 1× buffer, 200 μM dNTPs, 0.5 μM of each primer, 2.5 U of Mutazyme II DNA polymerase. PCR cycling conditions were 95°C for 2 min followed by 35 cycles of 95°C for 30 s, 55°C for 30 s and 72°C for 1 min. We performed two or three rounds of PCR mutagenesis in duplicate. Mutated amplicon libraries were further amplified with the same primers used for mutagenesis using Phusion polymerase (NEB). PCR reaction volume was 50 μl and consisted of ∼50 ng of mutated DNA, 1× HF buffer, 200 μM dNTPs, 0.5 μM of each primer, 1 U of Phusion polymerase. Eight PCR amplifications were performed using the PCR cycling conditions 98°C for 30 s, followed by 30 cycles of 98°C for 10 s and 72°C for 1 min. Amplified libraries were column purified (Macherey-Nagel) and stored at –20°C until further use.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!