Pfuultra

The mutant tAD fragments were transferred to pYES2‐hcM, a yeast expression vector pYES2 (Thermo Fisher Scientific, Waltham, MA, USA) into which a full‐length cDNA encoding human c‐Myb was inserted between its KpnI+NotI sites. The pYES2‐hcM contains the URA3 gene for selection in yeast and 2µ origin for high‐copy maintenance. Flanking the MCS is an inducible pGAL1 promotor and the CYC1 transcription terminator. The reporter plasmid was a derivative of pYHLfus‐3xGG [50], where a fusion of HIS3 and lacZ is driven by a synthetic Myb‐responsive promoter. The gene cassette with the dual‐reporter and its Myb‐responsive promoter was amplified by PCR using PfuUltra™ (Agilent, Santa Clara, CA, USA) and primers where a second BsrGI site was introduced through one of the primers. The purified PCR product was digested with BsrGI and inserted in pGADT7 (Clontech, Takara Bio Europe SAS, Saint‐Germain‐en‐Laye, France) digested with the same enzyme, resulting in the reporter pGADT7‐HLfus‐3xGG, where the selection marker is LEU2.

Anti-FAK[pY397] was from BD Biosciences. Anti-tubulin antibody was from Sigma. DyLight 549 conjugated goat anti-mouse IgG (H + L) was from Thermo Scientific. Fibronectin and recombinant human EGF were from Akron Biotech; Growth factor reduced Matrigel was from BD Bioscience. Pfu Ultra was from Agilent Technologies. Cold Fusion Cloning Kit was from System Biosciences (Palo Alto, CA). Anti-GFP monoclonal antibody and Safectine RU50 transfection kit were purchased from Syd Labs (Malden, MA). DNA primers were synthesized by Sigma-Aldria.

cDNAs of human FPR2/ALX and FPR1 (Missouri S&T cDNA Resource Center) were amplified by PCR (PfuUltra hotstart turbo, Agilent Technologies) and ligated into N-terminal signal sequence FLAG-tagged vectors (gift from Mark Von Zastrow, University of California, San Francisco (UCSF)). All truncations, point mutations, and amino acid additions were introduced by site-directed mutagenesis (PfuUltra, Agilent technologies). EGFP-β-Arr1, EGFP-β-Arr2, and EGFP-RAB5 were kind gifts from Prof. Mark von Zastrow (UCSF). EGFP-Rab11 was a kind gift from Dr. Rey Carabeo (University of Aberdeen).

WT and RK versions of aub were amplified with PfuUltra (Agilent) using previously published laboratory constructs as template (9 (link)) and the following primers CACCAATTTACCACCAAACCCTGTAAT and TTACAAAAAGTACAATTGATTCTGC. Amplicons were directionally cloned into pENTR/D-TOPO (Thermo Fisher Scientific) and recombined into Gateway vector pPHW (Drosophila Genomics Research Center). P-element–based Drosophila transgenesis followed (Genetic Services, Inc.).

The “Quick-Change” site-directed mutagenesis kit (Agilent) was used to introduce point mutations in the FKRP cDNA (Esapa et al., 2002 (link)). All constructs were verified by Sanger sequencing. The primers used to make the panel of FKRP mutants are shown in the Supplementary Table S1. Expression constructs for live cell imaging were generated from full length FKRP (wild type and those carrying single missense mutations) by PCR amplification using Pfu Ultra (Agilent) with the forward primer 5′-CGGGAA​TTCTGC​CCA​TGC​GGC​TCA​CCC​GCT​GC and the reverse primer 5′-CCGGAA​TTCGAC​CGC​CTG​TCA​AGC​TTA​AGA​G (EcoRI sites underlined). PCR products were sub-cloned into the EcoRI site of pEYFP-N1 vector (Clontech) fusing the fluorescent protein tag to the luminal C-terminus of FKRP. Myc-tagged constructs were generated as described previously (Esapa et al., 2005 (link)).

Anti-talin1 (clone 97H6) and anti-talin2 (clone 53.8) antibodies were from AbD Serotec. Anti-talin2 rabbit polyclonal antibody (PB9961) was from Boster (Pleasanton, CA). Anti-tubulin (C-terminus) mouse monoclonal antibody (TP1691) was from ECM Biosciences (Versailles, KY). Anti-GAPDH goat polyclonal antibody (A00191) was from Genescript (Piscataway, NJ). pLKO1 lentivirus shRNAs that respectively target talin1 and talin2 were from Sigma. Talin1 shRNA clones are TRCN0000123105 (#1), TRCN0000299020 (#2) and TRCN0000299022 (#3). Talin2 shRNA clones are TRCN0000122990 (#1) and TRCN0000122992 (#2). LentiCRISPRv2 and pSpCas9(BB)-2A-Puro V2.0, which were generated by Dr. Feng Zhang’s Laboratory [39 (link)], were from Addgene. Alexa488-labeled gelatin and Red FluoSpheres were from Life Technologies. Dylight 680 labeled goat anti-rabbit IgG (H+L) and Dylight 800-labeled goat anti-mouse IgG (H+L) were from Thermo Scientific. Fibronectin were from Akron Biotech. Growth factor- reduced Matrigel was from BD Bioscience. Pfu Ultra was from Agilent Technologies. Cold Fusion Cloning Kit was from System Biosciences (Palo Alto, CA). Anti-GFP monoclonal antibody and Safectine RU50 transfection kit were purchased from Syd Labs (Malden, MA). Standard VECTASTAIN ABC kit and ImmPACT DAB substrate kit were from Vector Laboratories, Inc. DNA primers were synthesized by Sigma-Aldrich.