Pgem t easy kit

Total nucleic acids were extracted from leaf samples as previously described [19 ]. For isolates SOL and ACL primer pair WTGF/WTGR [20 (link)] were used to PCR amplify an approximately 1500 bp fragment spanning all of the intergenic region and most of the Rep gene (data not shown). A specific pair of abutting primers BGAF/BGAR [21 (link)] containing a unique restriction enzyme (Apa1) site, to PCR-amplify the complete begomovirus genome. The full-length begomovirus from isolate ABF was PCR-amplified with primer pair BF/BR [22 (link)]. The full-length genome of the begomovirus from isolate ACN was PCR-amplified using abutting primers AAGCTTTGATGAGTTCCGCTG/AAGCTTCTCAAGCAGAGAATGGCG containing a unique HindIII restriction site designed to a partial sequence obtained with the universal begomovirus primers described previously [23 (link)]. Betasatellites were amplified with universal primers beta01/beta02 [24 (link)]. Potentially full-length amplification products for were cloned using either the InsT/A clone PCR product cloning kit (Fermentas) or the pGEM-T Easy kit (Promega), as recommended by the manufacturers.

Total RNA was extracted from leaves of Arabidopsis using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total RNA was used for first-stand cDNA synthesis using oligo (dT) and Superscript III first strand synthesis supermix (Life Technologies, Carlsbad, CA, USA). The AtOXC coding sequence was amplified by PCR using a 4 μL aliquot of the reverse transcription reaction, gene specific primers, 5′-ATGGCGGATAAATCAGAAACC-3′ and 5′-TTAGTTCTTGTGCTGTAATCTCC-3′, and Platinum Taq DNA Polymerase High Fidelity (Life Technologies) according to the manufacturer’s instructions. All hybridization steps were performed using a PTC-2 thermal cycler (MJ Research, BioRad, Hercules, CA, USA). The PCR product was cloned using the pGEM-T Easy kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions and verified by DNA sequencing (Eurofins Genomics, Louisville, KY, USA).

Total RNA was extracted from leaf sections of one 4-leaf seedling each of Spark and Rialto using Tri-Reagent (Sigma, St. Louis, USA) and cDNA was synthesized using MMLV-RT (Invitrogen, Carlsbad, USA) using the manufacturer’s protocols. Wheat ESTs and bespoke assemblies from the 454 5× raw data of hexaploid wheat Chinese Spring [[59 ]] were used to design primers in the untranslated regions (UTR) of TaGW2. Primers were designed to amplify the three homoeologous genomes. Using these primers and the cDNAs of Spark and Rialto, a RT-PCR was used to amplify the complete TaGW2 CDS of the two varieties (all three genomes). Purified RT-PCR products were modified with A-overhangs by incubating with 10 mM dATP and 1u of Taq polymerase (Promega, Madison, USA) in 1× manufacturer’s buffer for 10 mins at 72°C. They were then cloned directly using a pGEMT-Easy Kit (Promega) following the manufacturers’ instructions. Miniprep DNA of clones was insert-sequenced using M13 primers and sequenced by TGAC. Sequence reads were aligned and assigned to the A genome using the sequence of the flow sorted chromosome arm DNA [[66 (link)]] and the IWGSC survey sequence which became publicly available afterwards [[67 ]].