Toptaq dna polymerase

Manufactured by Qiagen

Sourced in Germany, United States

TopTaq DNA Polymerase is a thermostable enzyme used for DNA amplification in polymerase chain reaction (PCR) applications. It exhibits high thermal stability and robust performance to ensure reliable and consistent DNA amplification results.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

TopTaq polymerase (7 citations) DNA polymerase (4 citations) TopTaq DNA Polymerase Kits (2 citations)

25 protocols using toptaq dna polymerase

IL-12p40 Promoter Genotyping by ARMS-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping was performed by amplification refractory mutation system PCR (ARMS-PCR). The IL-12p40 promoter region was screened for two different already described alleles (GC/(GC) _del(CTC TAA)_ins) (rs17860508 [5 (link)]). The longer allele IL-12p40 pro1 is detected by the specific primer IL-12p40 5–8 (TGT CTC CGA GAG AGG CTC TAA), the 4 bp shorter allele IL-12p40 pro2 by IL-12p40 5–10 (TGT CTC CGA GAG AGG GCT GT). As generic 3′ primer IL12p40 3–5 (TGG AGG AAG TGG TTC TCG TAC) was used for both reactions (Primers from Eurogentec, Cologne, Germany). As control primers derived from the C reactive protein-gene CRP 3 and 5 were employed (CRP 3: CCA GCC TCT CTC ATG CTT TGG TTG GCC AGA CAG, CRP5: GGG TCG AGG ACA GTT CCG TGT AGA AGT GGA).
The reaction mix contained 10–20 ng genomic DNA, 1x PCR Buffer (Qiagen, Hilden, Germany, containing 15 mM MgCl₂), 1.5 μl MgCl₂ (25 mM), 0.5 μl dNTP 10 mM, 1U Top Taq DNA Polymerase (Qiagen Hilden, Germany), 5 pmol of each IL-12p40 primers and 2.5 pmol of each CRP primer. Taq activation was performed by an initial step of 95 °C (15 min), followed by 35 cycles (94 °C for 30s, 65 °C for 30s, 72 °C for 30s). PCR product was visualized in a 2.5 % agarose gel with 0.01 % ethidium bromide.

Eberhardt C.S., Haas J.P., Girschick H., Schwarz T., Morbach H., Rösen-Wolff A., Foell D., Dannecker G., Schepp C., Ganser G., Honke N., Eggermann T., Müller-Berghaus J., Wagner N., Ohl K, & Tenbrock K. (2015). No association of IL-12p40 pro1.1 polymorphism with juvenile idiopathic arthritis. Pediatric Rheumatology Online Journal, 13, 61.

+ Open protocol

+ Expand

Targeted Gene Sequencing from Blood

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA (gDNA) was extracted from blood using the Gentra Puregene Blood Kit (Qiagen; Hilden, Germany). Custom-made primers were designed and ordered using the Ion AmpliSeq Designer (ThermoFisher Scientific, MA, USA) and used to amplify a targeted gene panel of 300 genes resulting in 6203 amplicons of intronic and exonic sequences. The products were subjected to next generation sequencing on an Ion GeneStudio S5 System (ThermoFisher Scientific), and the results were analyzed on the Ion Reporter software (ThermoFisher Scientific) using customized filters. The IL7RA gDNA region of interest was amplified by polymerase chain reaction (PCR) with TopTaq DNA Polymerase (Qiagen) using forward primer 5’GAGACTTGGAAGATGCAGAACTG3’ and reverse primer 5’CACACCTGGGTTTGAAGATCC3’. The amplified PCR products were purified using the QIAquick PCR purification kit (Qiagen) and subjected to Sanger sequencing. Sequences were compared to the reference sequence NM_002185.4 of IL7RA published at the National Centre for Biotechnology Information, and analyzed using SnapGene viewer software (GSL Biotech LLC, CA, USA).

Mansour R., Bsat Y.E., Fadel A., El-Orfali Y., Noun D., Tarek N., Kabbara N., Abboud M, & Massaad M.J. (2022). Diagnosis and Treatment of a Patient With Severe Combined Immunodeficiency Due to a Novel Homozygous Mutation in the IL-7Rα Chain. Frontiers in Immunology, 13, 867837.

+ Open protocol

+ Expand

Genetic Analysis of BDNF Polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood samples were collected in EDTA tubes and stored at −20℃ until the experiments. Genomic DNA (gDNA) was extracted from samples using QIAamp DNA Blood Midi Kits (#51185, Qiagen, Valencia, CA, USA) according to the manufacturer's directions. Amplification of gDNA was carried out using TopTaq™ DNA Polymerase (#200205, Qiagen); the amplification conditions consisted of an initial denaturation at 94℃ for 5 min; followed by 35 cycles of denaturing at 94℃ for 30 sec, annealing at 60.5℃ for 30 sec, extension at 72℃ for 30 sec; and post-elongation at 72℃ for 10 min. Polymerase chain reaction (PCR) primers were designed with the following sequences of hBDNF: forward 5′-AAACATCCGAGGACAAGGTG-3′and reverse 5′-CCTCATGGACATGTTTGCAG-3′. PCR products were read with an automated ABI Prism 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and were scored using GeneScan, ver. 3.1 (Applied Biosystems). Met/Val BDNF polymorphism was determined with Reference SNP ID rs6265. The polymorphism distribution of the polymorphism did not deviate significantly from Hardy-Weinberg equilibrium (χ²(1)=0.51, p=0.47).29 (link)

Ryu J.S., Lee Y.M., Kim Y.S., Kang S., Park J.S., Ahn C.W., Nam J.S, & Seok J.H. (2021). Association between BDNF Polymorphism and Depressive Symptoms in Patients Newly Diagnosed with Type 2 Diabetes Mellitus. Yonsei Medical Journal, 62(4), 359-365.

+ Open protocol

+ Expand

Microbiome DNA Extraction and Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction was conducted in a clean bench (Heraguard ECO clean bench; Thermo Scientific). Total DNA of feces was extracted using the Qiagen Stool Minikit according to the manufacturer’s instructions (Qiagen, Germany). The 16S rRNA gene “hypervariable region V3” was amplified using barcoded PCR primers (V3-F, CCAGACTCCTACGGGAGGCAG; V3-R, CGTATTACCGCGGCTGCTG). The PCR mixtures included approximately 5 to 10 ng DNA template, 3 μmol of each primer in 20-μl volume of TopTaq buffer containing 2 U of TopTaq DNA polymerase (Qiagen, Germany). After denaturation at 94°C for 20 s, PCR amplification was conducted for 30 cycles using the following parameters: 2 min at 94°C predenaturation, 60°C annealing for 20 s, 72°C extension for 30 s, and held at 72°C for 10 min. The concentration and purity of DNA were evaluated on 1% agarose gels. DNA was diluted to 1 ng/μl using sterile water.

Liang Y., Dong T., Chen M., He L., Wang T., Liu X., Chang H., Mao J.H., Hang B., Snijders A.M, & Xia Y. (2020). Systematic Analysis of Impact of Sampling Regions and Storage Methods on Fecal Gut Microbiome and Metabolome Profiles. mSphere, 5(1), e00763-19.

+ Open protocol

+ Expand

Amplification and Sequencing of IL7RA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from PBMCs using TRIzol reagent (Sigma-Aldrich, MO, USA), and cDNA was synthesized using High-Capacity cDNA RT Kit (ThermoFisher Scientific). Exons 2-4 of IL7RA cDNA were amplified using TopTaq DNA Polymerase (Qiagen) with forward primer 5’GAGACTTGGAAGATGCAGAACTG3’ and reverse primer 5’TCCTGGCGGTAAGCTACATCG3’. The amplified cDNA bands were purified and subjected to Sanger sequencing.

+ Open protocol

+ Expand

E. coli O104:H4 DNA Extraction and PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Escherichia coli O104:H4 DNA extraction was performed using the InstaGene Matrix (Bio-Rad) according to manufacturer’s instructions. Primers used for the PCR assay were specific for the rfb_O104 gene, encoding the O-antigen specific for E. coli O104 (O104rfbO-f 5′ TGAACTGATTTTTAGGATGG 3′; O104rfbO-r 5′ AGAACCTCACTCAAATTATG 3′, amplicon size 351 bp) (Bielaszewska et al., 2011 (link)). A 50 μl PCR mixture contained: 25 μl 2× TopTaq Master Mix (Qiagen, Venlo, NL) (1.25 units of TopTaq DNA Polymerase, 1× PCR buffer, dNTPs concentration 0.2 mM each, 1.5 mM MgCl₂), 1 μl of each primer at the concentration of 0.2 μM, 18 μl of Nuclease-Free Water and 5 μl of template DNA. Amplifications were performed using the GeneAmp^® PCR System 9700 (Applied Biosystems, Life Technologies) and the following temperature cycling conditions: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 1 min, extension at 72°C for 1 min and final extension at 72°C for 7 min. The PCR products were resolved by electrophoresis on a 1,5% agarose gel.

Luciani M., Di Febo T., Zilli K., Di Giannatale E., Armillotta G., Manna L., Minelli F., Tittarelli M, & Caprioli A. (2016). Rapid Detection and Isolation of Escherichia coli O104:H4 from Milk Using Monoclonal Antibody-coated Magnetic Beads. Frontiers in Microbiology, 7, 942.

+ Open protocol

+ Expand

Amplification and Sequencing of Salmonid Gene Regions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Various sections of the sdY gene region of Tasmanian Atlantic salmon and brown trout were first amplified through PCR using TopTaq DNA polymerase (Qiagen) and primers stated in Table S1 to achieve overlapping sequences. Purified PCR products were cloned using either the pSTBlue-1 Acceptor vector kit or pJET 1.2 vector kit. DNA was extracted from 5 ml LB culture of five single colonies picked from each transformation. Restriction digestion was used to confirm the existence of positive inserts in the transformed bacteria prior to the recombinant plasmids being sent for sequencing by Genewiz.

Lubieniecki K.P., Lin S., Cabana E.I., Li J., Lai Y.Y, & Davidson W.S. (2015). Genomic Instability of the Sex-Determining Locus in Atlantic Salmon (Salmo salar). G3: Genes|Genomes|Genetics, 5(11), 2513-2522.

+ Open protocol

+ Expand

Multiplex PCR for Pathogenic E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

The presence of virulence genes eaeA, hlyA, stx₁, and stx₂ was verified by multiplex PCR according to methods described by Paton and Paton (1998 (link)). Template DNA was prepared by the boiling extraction method described above. DNA lysate (1 μl) from each isolate was amplified with TopTaq DNA Polymerase (Qiagen) in 25 μl reaction mixtures containing 1X Buffer Solution, 1X Coral Dye, 50 μM dNTP's (Invitrogen), 0.625 U/rxn TopTaq DNA Polymerase, 5 μl Q-solution, and 1 μM of eae and hlyA primers, and 0.4 μM of stx₁ and stx₂ primers. The PCR reaction was carried out under the following conditions in a thermal cycler (Biorad): 95°C for 3 min, followed by 35 cycles each consisting of a denaturation step at 95°C for 1 min; an annealing step at 65°C for 2 min for the first 10 cycles, decrementing 1°C per cycle to 60°C by cycle 15; and an elongation step at 72°C for 1.5 min, incrementing to 2.5 min from cycles 25–35; and a final extension step at 72°C for 5 min. PCR products were visualized in SYBR^®; Safe (Invitrogen) stained 2% agarose gels following electrophoresis using 1X TAE buffer (BioRad) at 80 V for 45 min. The clinical E. coli O157:H7 isolate (Strain ID, BC Centre for Disease Control, stx₁, stx₂, eaeA, hlyA positive)was used to verify PCR assay performance.

Nadya S., Delaquis P., Chen J., Allen K., Johnson R.P., Ziebell K., Laing C., Gannon V., Bach S, & Topp E. (2016). Phenotypic and Genotypic Characteristics of Shiga Toxin-Producing Escherichia coli Isolated from Surface Waters and Sediments in a Canadian Urban-Agricultural Landscape. Frontiers in Cellular and Infection Microbiology, 6, 36.

+ Open protocol

+ Expand

Porcine OGT Gene Intron 20 Polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers were designed to amplify across the intron 20 based on the porcine OGT cDNA (GenBank accession no. DQ400859) and the gene sequence in the Genome Browser for pig (http://genome.ucsc.edu/). The forward (2968F) and reverse (3083R) primers correspond to bases 2968–2987 and 3083–3059 of the porcine OGT cDNA (GenBank accession no. DQ400859), respectively, and the expected size of the PCR amplicon across intron 20 was 631 bp. PCR reactions were carried out in a 20-μl volume containing 30 ng of genomic DNA, 2 mM MgCl₂, 10 pmol of each primer (OGT-2968F: 5′-GCACACCACAGGGATGGATG-3′ and OGT- 3083R: 5′- GCTCAAGACAACCTAAACAAGTAAG-3′), 200 μM dNTP, and 2 U Top-Taq™ DNA polymerase (Qiagen, Germany). Amplification was performed under the following PCR conditions: 10 min at 95°C; 35 cycles of 30 sec at 95°C, annealing for 30 sec at 60°C, and 1 min at 72°C; and a final extension of 5 min at 72°C. Length polymorphism among the pig breeds was determined after gel electrophoresis. Genotypes of the OGT gene among the Duroc, Landrace, Yorkshire, KNP, Meishan, and Duroc x KNP pigs (n = 176) were determined. A number of pigs were sequenced to confirm the OGT genotypes of Duroc, KNP, and Meishan pigs.

Nam Y.S., Kim D.W., Kim M.J., Cho K.H, & Kim J.G. (2015). Length polymorphism in OGT between Korean native pig, Chinese Meishan, and the Western pig breeds. Journal of Animal Science and Technology, 57, 12.

+ Open protocol

+ Expand

Molecular Detection of Anaplasma marginale

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anaplasma marginale identification was carried out by amplifying two species-specific genes: msp5, a single-copy gene that encodes the outer major surface protein MSP5 [38 (link)]; and msp1β, a three-copy gene fragment that encodes the outer major surface protein MSP1b [39 (link)]. The molecular amplifications were performed in a 20 µL reaction mixture containing 0.4 μM of each primer, 0.2 mM of each deoxyribonucleotide triphosphate (INBIO Highway, Buenos Aires, Argentina), 0.5 U of Top Taq DNA polymerase (Qiagen, Hilden, Germany), 2 μL of 10X PCR buffer and ~100 ng of genomic DNA under published conditions [38 (link),39 (link)]. Positive (DNA from A. marginale Mercedes strain) and negative (pure water) controls were included in the assay. Each amplified product (10 μL) was analyzed by electrophoresis in 1.5% agarose gel stained with ethidium bromide and a molecular size marker (1 Kb Plus DNA Ladder, Invitrogen, Carlsbad, CA, USA).

de la Fournière S., Guillemi E.C., Paoletta M.S., Pérez A., Obregón D., Cabezas-Cruz A., Sarmiento N.F, & Farber M.D. (2023). Transovarial Transmission of Anaplasma marginale in Rhipicephalus (Boophilus) microplus Ticks Results in a Bottleneck for Strain Diversity. Pathogens, 12(8), 1010.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!