Pcr topoii

To check gene expression, intestines dissected out from 4 and 5 dpf larvae were used. RNA was extracted using a trizol (Invitogen, USA) based method. cDNA synthesis was carried out using up to 1 μg RNA using a cAMV reverse transcription kit (Invitrogen, USA). The following primers were used for PCR: myosin-Vaa (Forward: 5′gaacaaggagaaccgttcca3′; Reverse: 5′gtacgcaggagaaccaggag3′), myosin-Vb (Forward1: 5′ acgagagacaacgatatcag 3′; Reverse1: 5′cttgttgagttgacgatttgg 3′; Forward2: 5′acgagaatctggctgttgct3′; Reverse2: 5′gcagcaggttgtagccatct3′), myosin-Vc (Forward: 5′ acgggctcaagggttagaaa3′; Reverse: 5′gcttgaagctgctcgttctc3′) and β-actin (Forward: 5′aaggccaacagggaaaagat3′; Reverse: 5′aagtggtctcgtggataccg3′).
Using primers, a region of myosin Vb (NM_001161632.1; bp 2967–3866) - with low homology to the other two paralogues - was amplified and cloned into pCR TOPOII (Invitrogen, USA). Templates were linearised to synthesise probes using either T7 or SP6 RNA polymerase from DIG RNA Labelling Kit (Roche, Switzerland). In situ hybridisations were performed using a protocol described earlier with a few modifications (Nüsslein-Volhard and Dahm, 2002 ).

Specific regions from cdh1, cldn7b, cldne, oclna, dsc2l, and grhl3 (2208–2635 bp, 338–1065 bp, 90–818 bp, 928–1646 bp, 2206–2928 bp and 2140–2659 bp, respectively) were amplified using reverse transcribed total RNA isolated from 48 hpf embryos as a template. Subsequently, they were cloned into pCR TOPO 2.1 or pCR TOPOII (Invitrogen). For RNA probe synthesis, PCR amplicons obtained using appropriate generic primer sites flanking the probe sequence in the vector (T7, Sp6, M13F, M13R) were used as templates. Probes were synthesized using either T7 or SP6 RNA polymerase (Roche DIG RNA Labelling Kit). In situ hybridizations were performed as described earlier with a few modifications (Schulte-Merker, 2002). The stained samples were imaged using Zeiss SteREO Discovery coupled with AxioCam.

The primers were designed for amplification of specific regions for myoVaa (NM_001080959.2; bp 2880–3795), myosin Vb (NM_001161632.1; bp 2967–3866), myoVc (XM_686051.3; bp 2920–3720) using Primer3 (version 0.4.0) and cloned into pCR TOPO 2.1 or pCR TOPOII (Invitrogen). For RNA probe synthesis, templates were linearised and probes were synthesized using either T7 or SP6 RNA polymerase (Roche DIG RNA Labelling Kit). In situ hybridisations were performed as described [82] with a few modifications. For sectioning, embryos were post-fixed in 4% PFA after the completion of in situ hybridisation protocol and embedded in Epon. Sections were cut at 3 µ thickness using glass knives on Leica microtome, placed on a glass slide coated with 1% gelatin, counterstained with 4% eosin made in 90% ethanol and mounted in DPX. Sections were imaged on Zeiss ApoTome using Axiocam.