Mission shrna lentiviral system

SUM149 cells were purchased from Asterand (Detroit, MI) and cultured in F12 medium (Sigma) supplemented with fetal bovine serum (FBS; 5%), penicillin-streptomycin (100 units/mL), insulin (5 μg/mL), and hydrocortisone (1 μg/mL). BT549 cells were purchased from ATCC (Manassas, VA) and cultured in RPMI-1640 medium (Sigma) supplemented with FBS (10%) and penicillin-streptomycin (100 units/mL). Cells were passaged every 3 days and authenticated twice a year at the Characterized Cell Line Core Facility at MD Anderson Cancer Center through genotyping (in August 2014, October 2014, January 2015, November 2018). Stable cell lines were created using an shRNA lentiviral system (Mission shRNA Lentiviral System, Sigma). Briefly, SUM149 and BT549 cells were transduced with shRNA against scrambled control, ERK1 (TRCN0000006150: CCGGCCTGAATTGTATCATCAACATCTCGAGATGTTGATGATACAATTCAGGTTTTT; TRCN0000006151: CCGGCGACCTTAAGATTTGTGATTTCTCGAGAAATCACAAATCTTAAGGTCGTTTTT), and ERK2 (TRCN0000010039: CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTT; TRCN0000010040: CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTT); stably transfected cells were selected in media containing puromycin. Stable SUM149 copGFP-labeled cells were created by infection with the pCMV-copGFP lentiviral vector (System Biosciences) and sorted by flow cytometry-based on GFP expression.

The MISSION^® shRNA lentiviral system (Sigma-Aldrich; St. Louis, MO) was used to generate lentiviral particles as previously described^{49 (link)}. The shRNA constructs used are as following: non-targeting control shRNA SHC002 (control 002) (G418-resistant version for the xenograft studies and puromycin resistant version in all other experiments), non-targeting control shRNA SHC216 (control 216), c-Jun shRNA#1 (TRCN0000010366; G418-resistant version for the xenograft studies and puromycin resistant version in all other experiments), c-Jun shRNA#4 (TRCN0000039590), c-Jun shRNA#5 (TRCN0000039591), c-Jun shRNA#2-1 (TRCN0000355645), c-Jun shRNA#2-3 (TRCN0000355647), JunB shRNA#1 (TRCN0000014943; G418-resistant version for the xenograft studies and puromycin resistant version in all other experiments), JunB shRNA#3 (TRCN0000014945), JunB shRNA#5 (TRCN0000014947) and JunB shRNA#6 (TRCN0000232087). Of note, SHC002 is predicted not to target any known mammalian genes, whereas SHC216 is predicted not to target any known gene from any species⁵⁰ . Cells were placed in selection media containing 0.5 μg/ml puromycin or 750 μg/ml G418 (cells used in xenograft studies only) and experiments were performed between 1–3 weeks after selection.