We used SALSA P081/P082 NF1 MLPA kit (MRC Holland, Amsterdam, The Netherlands) to confirm and identify single and multiple exon deletions/duplications according to the manufacturer’s protocol. Each samples containing 100 ng of genomic DNA was used for overnight hybridization with the probemixes. After ligation and amplification were performed with FAM-labeled primers, the PCR products were analyzed on a Genetic Analyzer 3730 capillary electrophoresis system and interpreted using Genotyper version 2.0 (Applied Biosystems, CA, USA). In this study, we used the Coffalyser program (version 3.5) for peak area normalization and gene dosage calculation.
Genotyper version 2
Manufactured by Thermo Fisher Scientific
Sourced in United States, Canada
Genotyper version 2.0 is a lab equipment product designed for genetic analysis. It functions as a software-based tool for processing and analyzing genotypic data.
Automatically generated - may contain errors
Lab products found in correlation
5 protocols using genotyper version 2
1
Multiplex Ligation-Dependent Probe Amplification for NF1 Analysis
2
Microsatellite Genotyping of North Atlantic Eels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nearly all North Atlantic eel specimens (n = 1042) have been successfully genotyped using nine microsatellite markers. Original genotypes for seven microsatellite loci [39 (link),40 (link)] were supplemented with two additional loci, Ang075 (Genbank AF237903; Primer sequences, Ang075-F, TATCAGGAACTCGATACGCC, and, Ang075-R, ACGCATCACCAGCCCTTGC), and Aro146 (AF237904; Aro146-F, CAGTTATCCATCTACAGGTG, and, Aro146-R, GAAATAAGAGAATGAGACTCTG). The same genotyping procedure was applied to the other eel species. The fragment sizes were determined by reference to a size standard using the software Genescan version 2.1 and Genotyper version 2.0 (Applied Biosystems Inc., Foster City, CA). Allelic diversity, genetic variation and deviation from Hardy-Weinberg Equilibrium (HWE) were calculated with Genepop on the web [107 ] and Genetix version 4.05 [108 (link)]. All microsatellites were tested for null alleles using Micro-Checker [78 (link)]. Allelic diversity and private allelic richness were also inferred after correcting for unequal sampling sizes using HP-rare [109 (link)]. Pairwise genetic differentiation was calculated with Arlequin version 3.1 [110 ] and statistical significance was inferred after 10,000 permutations.
3
Androgen Receptor CAG Repeat Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The method for analyzing the CAG repeat polymorphism in the AR gene has been described in detail previously.11 (link)12 (link) Briefly, exon 1 of the AR gene was amplified using the forward 5’-TCCAGAATCTGTTCCAGAGCGTGC-3’ and reverse 5’-GCTGTG-AAGGTTGCTGTTCCTCAT-3’ primers flanking the CAG repeat. One of the primers was marked with Cy5.5 fluorescent dye. Amplification was performed in a 25 μl reaction volume containing 50 ng of genomic DNA and 200 μmol l−1 of each deoxynucleotide triphosphate. The concentration of the primer was 1.2 μmol l−1. PCR conditions were set as follows: 30 cycles of 95°C for 45 s, 56°C for 30 s and 72°C for 30 s for amplification. The PCR program was initiated with a denaturation step at 95 °C for 5 min and terminated with an extension step at 72°C for 5 min.13 (link) The PCR products were analyzed on a Genescan-run ABI 377 DNA gel-slab electrophoresis sequencer (Perkin-Elmer, Co, Norwalk, CT, USA) with a TAMRA-labeled internal length standard (Genescan-500 TAMRA, Applied Biosystems, Foster City, CA, USA). Genotyper software was used to determine the genotypes (Genotyper version 2.0, Applied Biosystems).14 (link)
4
Y-Chromosome STR Typing Using PowerPlex Ⓡ Y23 System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplification and typing of Y-chromosome STRs targeted the following loci: DYS576, DYS389I, DYS389II, DYS448, DYS19, DYS391, DYS481, DYS549, DYS533, DYS438, DYS437, DYS570, DYS635, DYS390, DYS439, DYS392, DYS643, DYS393, DYS458, DYS385a, DYS385b, DYS456, and GATA-H4. Typing was performed using the Investigator PowerPlex Ⓡ Y23 System PCR Amplification kit (Promega).
Table 1 shows the positional information for each STR. The sequences of the primers used in this kit were not disclosed by the manufacturer.
Nakamura Y et al.
An ABI PRIZM 3130 Genetic Analyzer (Applied Biosystems, USA) was used to perform electrophoresis under the conditions described in the manufacturer's recommendations. Fragment sizes were determined automatically using GeneScan Analysis software 3.1 (Applied Biosystems) and the results analyzed using Genotyper version 2.5 (Applied Biosystems).
Table 1 shows the positional information for each STR. The sequences of the primers used in this kit were not disclosed by the manufacturer.
Nakamura Y et al.
An ABI PRIZM 3130 Genetic Analyzer (Applied Biosystems, USA) was used to perform electrophoresis under the conditions described in the manufacturer's recommendations. Fragment sizes were determined automatically using GeneScan Analysis software 3.1 (Applied Biosystems) and the results analyzed using Genotyper version 2.5 (Applied Biosystems).
5
Autosomal STR Profiling using Investigator Identifiler Plus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Investigator Identifiler Ⓡ Plus Amplification kit (Applied Biosystems) was used for PCR amplification and typing of autosomal STRs at the following loci: D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818, and FGA. Table 1 shows the positional information on each STR. The primer information of this kit is not disclosed.
The ABI PRIZM 3130 Genetic Analyzer (Applied Biosystems) was used to perform electrophoresis under the conditions described in the manufacturer's recommendations. Fragment sizes were automatically determined using the GeneScan Analysis software 3.1 (Applied Biosystems) and the results analyzed using Genotyper version 2.5 (Applied Biosystems).
The ABI PRIZM 3130 Genetic Analyzer (Applied Biosystems) was used to perform electrophoresis under the conditions described in the manufacturer's recommendations. Fragment sizes were automatically determined using the GeneScan Analysis software 3.1 (Applied Biosystems) and the results analyzed using Genotyper version 2.5 (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!