Total RNA was isolated from brain tissue using the Trizol reagent (Ambion) and reverse transcribed using the QuantiTect Reverse Trancription Kit (Qiagen). RT-qPCR for ER chaperone genes and GAPDH was performed using the Maxima SYBR Green/ROX qPCR Master Mix assay (Thermo Scientific). The primers for RT-qPCR are listed in Table 2 . RT-qPCR and subsequent calculations were performed by a StepOnePlus™ Real-Time PCR System (Applied Biosystem).
Quantitect reverse trancription kit
Manufactured by Qiagen
The QuantiTect Reverse Transcription Kit is a laboratory product designed for the efficient conversion of RNA to cDNA. It provides a convenient, reliable, and sensitive method for performing reverse transcription reactions.
Automatically generated - may contain errors
2 protocols using quantitect reverse trancription kit
1
Brain Tissue RNA Expression Analysis
2
RNA Extraction and qRT-PCR for REDD1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed using the RNeasy Mini Kit (Qiagen). RNA was reverse transcribed to cDNA using the Quantitect Reverse Trancription Kit (Qiagen). For qRT-PCR, 50 ng of cDNA was mixed with primers towards REDD1 (Forward 5’-ACAGTTCTAGATGGAAGACC-3’, Reverse 5’-ACAGTTCTAGATGGAAGACC-3’ or RPL32 (Forward 5’-GTGCAACAAATCTTAC-TGTG, Reverse 5’- CTGCCTACTCATTTTCTTCAC).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!