The abundance of aclB and cbbM genes was determined by a quantitative real-time PCR method using the same primers and conditions for cloning these genes described above. The PCR was carried out in an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany) using SYBR ExScript RTqPCR Kit (Takara, Dalian, China) as described previously [44 (link)]. Melting curve analysis was performed at the end of PCR to confirm that only one PCR product was amplified and detected.
Sybr exscript rt qpcr kit
Manufactured by Takara Bio
Sourced in United States, China
The SYBR ExScript RT-qPCR Kit is a reagent kit designed for reverse transcription and real-time quantitative PCR (RT-qPCR) analysis. The kit contains all the necessary components, including reverse transcriptase enzyme, PCR master mix, and SYBR Green dye, to perform sensitive and reliable gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Primerscript 1st strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Rnase free dnase 1, by Promega (3 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Mastercycler, by Eppendorf (1 mentions)
Reverse transcription system, by Promega (1 mentions)
E z n a total rna kit, by Omega Bio-Tek (1 mentions)
Rnaprep tissue kit, by Tiangen Biotech (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Abi prism 7300 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
8 protocols using sybr exscript rt qpcr kit
1
Quantitative Real-Time PCR for aclB and cbbM
2
Quantification of Oct4 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from the cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocols. Subsequently, the cDNA was synthesized with a reverse transcription System (Promega, Madison, WI, USA) according to manufacturer’s instructions. RT-qPCR was completed using the SYBR ExScript RT-qPCR kit (Takara Biotechnology Co., Ltd.). The primers of Oct4 were as follows: 5′-CTGCAGAAGGAGCTAGAACAGTTTG-3′ (sense) and 5′-GATGGTGGTCTGGCTGAACACCTTTCC-3′ (anti-sense); and GAPDH, 5′-GCCAAAAGGGTCATCATCTC-3′ (sense) and 5′-GTAGAGGCAGGGATGATGTTC-3′ (anti-sense). The PCR program was as follows: Denaturation at 95℃ for 10 min; followed by 40 cycles at 95℃ for 10 s, 60℃ for 1 min. The mRNA levels were quantified using the 2−∆∆Cq method and normalized to GAPDH.
3
RT-qPCR Analysis of PoCD9.1 and PoCD9.3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR analysis of PoCD9.1 and PoCD9.3 expression under normal conditions was performed as follows. Total RNA from the spleen, liver, head kidney, blood, intestine, muscle, gill, and brain of five fish was extracted using an EZNA Total RNA Kit (Omega Bio-tek, Doraville, GA, USA). Total RNA was treated with DNase I to remove residual DNA. One microgram of total RNA was used for cDNA synthesis with a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). RT-qPCR was performed using a Roche LightCycler 96 system (Switzerland) with a SYBR ExScript RT-qPCR Kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) [38 (link)]. PCR was performed in a 20 μL volume containing 10 μL of SYBR® Premix Ex Taq™, 0.2 μM of each specific primer pair PoCD9.1RTF/R and PoCD9.3RTF/R, and 2 μL of diluted cDNA (100-fold dilution). The PCR conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 20 s. Melting curve analysis of the amplification products was performed at the end of each PCR to confirm that only one product was amplified. The expression levels of PoCD9.1 and PoCD9.3 were analysed using the comparative threshold cycle method (2−ΔΔCT) with beta-actin as an internal reference [39 (link), 40 (link)]. The experiment was performed in triplicate.
4
Expression Profiling of TFPI-1 and TFPI-2 in Flounder
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brain, heart, gills, head kidney, spleen, liver, muscle, blood and intestines were taken aseptically from five flounder and used for total RNA extraction with the RNAprep Tissue Kit (Tiangen, Beijing, China). One microgram of total RNA was used for cDNA synthesis with the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). RT-qPCR was carried out in a LightCycler 96 system (Roche Applied Science, North Carolina, USA) using the SYBR ExScript RT-qPCR Kit (Takara, Dalian, China) as described previously [27 (link)]. The flounder β-actin gene was used as an internal control. The primers were listed in Table 1 . Melting curve analysis was carried out at the end of each PCR to confirm the specificity of PCR products. The expressions of TFPI-1 and TFPI-2 were analyzed using comparative threshold cycle method (2−ΔΔCT). All data are given in terms of relative mRNA levels to that of tissues in which TFPI-1 or TFPI-2 expression was the lowest.
Primers used in quantitative real-time PCR
| Primers | Sequences (5′-3′) |
|---|---|
| Po-Actin RTF | ACCGCTGCCTCCTCCTCAT |
| Po-Actin RTR | TCGGGACAACGGAACCTCTC |
| TFPI-1 RTF | GATGTTGTCCAAGCAACTGAAG |
| TFPI-1 RTR | GACTGAAGCACAGCCTCTTAT |
| TFPI-2 RTF | GGAAATGCTCGGCCTCTATTA |
| TFPI-2 RTR | CTCTGCCTGGAGACAAAGTT |
5
Quantitative RT-PCR Protocol for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and the isolated RNA was treated with RNase-free DNase I (Promega Corporation, Madison, WI, USA). The concentration and purity of isolated RNA were measured with a spectrophotometer. Purified RNA (0.5 µg/µl) with nuclease-free water was used for cDNA synthesis using the PrimerScript 1st Strand cDNA Synthesis kit (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Expression levels of target genes were detected in an Eppendorf Mastercycler (Brinkmann Instruments, Inc.; Thermo Fisher Scientific, Inc.) using the SYBR ExScript RT-qPCR kit (Takara, China). Melting curve of amplification products was analyzed at the end of each PCR to confirm that only one product was amplified and detected. PCR was conducted under the following parameters: 1 predenaturation cycle of 1 min at 94°C, 34 cycles of 95°C for 15 sec, 60°C for 30 sec, 72°C for 2 min and a final extension at 72°C for 5 min. GAPDH was chosen as the internal control. The expression levels were calculated using the 2−ΔΔCq method (15 (link)). Primers used for targets amplification are listed in Table I .
6
qRT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HCC blood samples and HepG2 cells using RNAiso Plus reagent (Takara Bio Inc., Dalian, P.R. China). The concentration and purity of isolated RNA were then measured using an ultraviolet spectrophotometer (SMA 400 UV-VIS; Merinton, Shanghai, P.R. China). Reverse transcription for cDNA synthesis was then performed using PrimeScript RT Reagent Kit (Takara) in accordance with the manufacturer’s protocol. Then the qRT-PCR was performed in the ABI PRISM 7300 Fast Real-Time PCR System (Ambion, Foster City, CA, USA) to detect the expression of targets using the SYBR ExScript RT-qPCR Kit (Takara). The reaction for target amplification was performed under conditions of 95°C for 10 s, 95°C for 30 s, and 40 cycles at 60°C for 30 s. Moreover, melting curve analysis was performed at the end of each PCR to confirm that only one product was amplified. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control, and the relative expression of targets was calculated with the 2−ΔΔCt method. Primers were designed by Primer 5.0 (Primer-E, Ltd., Plymouth, UK) and are shown in Table 1 .
7
Quantitative RNA Expression Analysis of OVCAR-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the cells collected at 48 h was isolated using TRIzol reagent (Invitrogen) as previously described (16 (link)) and was treated with RNase-free DNase I (Promega Biotech, USA). Consequently, the concentration and purity for the isolated RNA were measured with SMA 400 UV-VIS (Merinton, Shanghai, China). Purified RNA at a density of 0.5 µg/µl with nuclease-free water was used for cDNA synthesis with the PrimerScript 1st Strand cDNA Synthesis Kit (Invitrogen, USA). Expressions of targets in OVCAR-3 cells were detected in an Eppendorf Mastercycler (Brinkman Instruments, Westbury, NY, USA) using the SYBR ExScript RT-qPCR Kit (Takara, China). Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one product was amplified and detected. Phosphoglyceraldehyde dehydrogenase (GAPDH) was chosen as the internal control. Primers used for target amplification were CDH1 sense 5′-AGCTACCCCAGGACACCCAA-3′ and antisense 5′-GCAACGCAATCAGAGTCAACG-3′; GAPDH sense 5′-GGGTGGAGCCAAACGGGTC-3′ and antisense 5′-GGAGTTGCTGTTGAAGTCGCA-3′.
8
Quantification of miR-424 and TNFAIP1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from cells with Trizol (Invitrogen) according to the manusfactuer's protocol. The isolated RNA was treated with RNase-free DNase I (Promega Biotech, Madison, WI) to remove the mixed DNA. Consequently, concentration and purity of isolated RNA were measured with SMA 400 UV-VIS (Merinton, Shanghai, China). Purified RNA was used for cDNA synthesis with the PrimerScript 1st Strand cDNA Synthesis Kit (Invitrogen). Expressions of targets were detected in an Eppendorf Mastercycler (Brinkman Instruments, Westbury, NY) using the SYBR ExScript RT-qPCR Kit (Takara, Dalian, China). The total reaction system of 20 μL volume was as follows: 1 μL cDNA from the above PCR, 10 μL SYBR Premix EX Taq, 1 μL each of the primers (10 μM), and 7 μL ddH 2 O. The PCR program was as follows: denaturation at 50°C for 2 min; 95°C for 10 min; followed by 45 cycles of 95°C for 10 s, and 60°C for 1 min. Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one product was amplified and detected. Phosphoglyceraldehyde dehydrogenase (GAPDH) was chosen as the internal control. Primers used for targets amplification were as follows: miR-424 sense: 5'-AGC AGC AAT TCA TGT TTT GAA G-3', antisense: 5'-GCA GCG CCT CAC GTT TT-3', and TNFAIP1 sense: 5'-ATA GAC ACG GAT TAC CCA CC-3', antisense: 5'-CAG GCT TTG CTC AAT GC-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!