Abi7300 apparatus

All primers of the candidate gene were designed using Primer 5.0 software, and the sequences are provided in Supplementary Table S1. One microgram of total RNA was used for the cDNA synthesis using HiScript Q RT SuperMix (Vazyme). qRT-PCR analysis was performed using ChamQ SYBR Color qPCR Master Mix (Vazyme) and carried out on a ABI7300 apparatus (Applied Biosystems, UK) with the following program: initial denaturation at 95°C for 5 min, followed by 40 cycles of 5 s at 95°C, 30 s at 58°C, and 40 s at 72°C. Each sample was run in triplicate, and the average threshold cycle (Ct) was calculated. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used to normalize the expression levels, and the relative gene expression levels of the target genes were calculated using the 2^-ΔΔCT method (22 (link)).

Total RNA was extracted using an RNeasy Mini Kit (Qiagen) and subjected to DNase treatment (Invitrogen), and reverse transcription were performed using Moloney murine leukemia virus reverse transcriptase (Invitrogen). Quantitative reverse transcriptase PCR (qRT-PCR) analysis was performed with using SYBR Premix Ex Taq II (TAKARA) and the ABI7300 apparatus (Applied Biosystems). Primer sequences for Gpr43 (mouse), Tnfα (mouse) and GPR43 (human) have been described previously[18 (link)]. Other primer sequences are as follows: F4/80 (mouse), 5’- GATGTGGAGGATGGGAGATG -3’ (forward) and 5’- ACAGCAGGAAGGTGGCTATG -3’ (reverse); Mcp-1 (mouse), 5’- AATCTGAAGCTAATGCATCC -3’ (forward) and 5’- GTGTTGAATCTGGATTCACA -3’ (reverse); Il6 (mouse), 5’- GGAGTACCATAGCTACCTGG -3’ (forward) and 5’- AGGAATGTCCACAAACTGAT -3’ (reverse); Inos (mouse), 5’- TGGTGGTGACAAGCACATTT -3’ (forward) and 5’- AAGGCCAAACACAGCATACC -3’ (reverse); Mrc1 (mouse), 5’- CAAGGAAGGTTGGCATTTGT -3’ (forward) and 5’- CCTTTCAGTCCTTTGCAAGC -3’ (reverse); 18S (mouse), 5’- ACGCTGAGCCAGTCAGTGTA -3’ (forward) and 5’- CTTAGAGGGACAAGTGGCG -3’ (reverse), Pparg2 (mouse), 5’- GCTGTTATGGGTGAAACTCTGG -3’ (forward) and 5’- TTCTTGTGAAGTGCTCATAGGC -3’ (reverse), Cd45 (mouse), 5’- tcgtgcccaaacaaattaca -3’ (forward) and 5’- taggcttaggcgtttctgga -3’ (reverse).