Rneasy

Manufactured by Qiagen

Sourced in Germany, United States, Spain, Netherlands, United Kingdom, Canada, Japan, France, Sweden, China, Denmark

The RNeasy is a lab equipment product designed for the isolation and purification of RNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify RNA, ensuring high-quality and yield.

Automatically generated - may contain errors

Lab products found in correlation

1 150 protocols using rneasy

Regulating ADIRF-AS1 in Renal Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

786O cells expressing dCas9-BFP-KRAB (Addgene #85969) and LRG2.1T (sgRNA against NT, ROSA or ADIRF-AS1 and GFP) were seeded at 150,000 cells/mL. After 48 h, total RNA was collected (Qiagen, RNeasy). For DKO cells, 786O sgCtrl and sgPBRM1–1 (lentiCRISPRv2) polyclonal cell lines were transfected using PX458 with flanking sgRNAs targeted to ADIRF-AS1 (set 2: GCAAGGCATACACCGTACCGGGG, TCAACCGTGCTCCTGCAGGGAGG) or the empty vector control. Single cell clones were screened as described above using primers flanking the cut site. DKO cell lines were seeded at 150,000 cells/mL into 6 well plates and total RNA was collected after 48 h (Qiagen, RNeasy).

Brooks R., Monzy J., Aaron B., Zhang X., Kossenkov A., Hayden J., Keeney F., Speicher D.W., Zhang L, & Dang C.V. (2022). Circadian lncRNA ADIRF-AS1 binds PBAF and regulates renal clear cell tumorigenesis. Cell reports, 41(3), 111514.

+ Open protocol

+ Expand

BoNT-A Induced Muscle Tissue RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were prepared for 5 groups (n =4/group)
that included tissue from TAs of BoNT-A–injected rats at 1, 4, 12, and
52 weeks after injection. Control tissue was obtained from the contralateral TA
of saline-injected rats euthanized at 12 weeks. RNA was extracted with Trizol
(Invitrogen, Carlsbad, California) and RNeasy (Qiagen, Valencia, California).
Briefly, 30 mg of frozen tissue was mixed with 0.5 ml of Trizol and homogenized
at 4°C in a bullet blender (Next Advance, Inc., Averill Park, New York).
The homogenate was mixed with 100 μl of chloroform, and
samples were incubated for 2 minutes at room temperature and spun at 4°C
for 15 minutes. The aqueous portion was removed and mixed with equal amounts of
70% ethyl alcohol. The solution was then washed through an RNeasy spin
column, incubated for 15 minutes with RNAse-free DNAse (Qiagen), washed 3 times,
and eluted according to the manufacturer’s instructions. Absorbance was
measured at 260 nm to determine RNA concentration, and the 260/280-nm absorbance
ratio was calculated to determine RNA purity. RNA was reverse-transcribed into
cDNA using a synthesis system (SuperScript First-Strand Synthesis System; Life
Technologies, Grand Island, New York).

MUKUND K., MATHEWSON M., MINAMOTO V., WARD S.R., SUBRAMANIAM S, & LIEBER R.L. (2014). SYSTEMS ANALYSIS OF TRANSCRIPTIONAL DATA PROVIDES INSIGHTS INTO MUSCLE’S BIOLOGICAL RESPONSE TO BOTULINUM TOXIN. Muscle & nerve, 50(5), 744-758.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Tight Junction Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The procedure used for quantitative real-time PCR was described previously [28 (link)]. For the in vitro models, total RNA from cultured ECs from different groups was extracted separately using RNeasy (Qiagen, Valencia, CA, USA) per the manufacturer's recommendations. For the in vivo models, total RNA from strial capillaries of control and LPS-treated groups was extracted separately using RNeasy (QIAGEN). Each group of 5 mice was analyzed for ZO-1, occludin, ve-cadherin, and Gapgh mRNA with qRT-PCR. The sample for total RNA was reverse transcribed with a RETROscript kit (Invitrogen, USA). CDNA synthesized from total RNA was diluted 10-fold with DNase-free water, each cDNA sample independently measured 3 times. Transcripts were quantitated by gene expression assay (Invitrogen): ZO-1 (Mm00493699_m1), occludin (Mm00500912_m1), and ve-cadherin (Mm03053719_s1) on a model 7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The real-time PCR was cycled at 95°C for 20 s, 40 cycles at 95°C for 1 s, and 60°C for 20 s. Mouse Gapdh was the endogenous control. Quantitative PCR was performed per the guidelines provided by Applied Biosystems and analyzed using the comparative cycle threshold method.

Zhang J., Chen S., Hou Z., Cai J., Dong M, & Shi X. (2015). Lipopolysaccharide-Induced Middle Ear Inflammation Disrupts the cochlear Intra-Strial Fluid–Blood Barrier through Down-Regulation of Tight Junction Proteins. PLoS ONE, 10(3), e0122572.

+ Open protocol

+ Expand

RNA Extraction from G. tigrina Planarians

Check if the same lab product or an alternative is used in the 5 most similar protocols

G. tigrina (Ward’s Natural Science, Rochester, NY) colonies were maintained in aerated spring water. Planarians were starved for one week prior to RNA isolation. Five animals were randomly selected per experimental condition on day 7. Each group was washed repeatedly with spring water and tissue grinding was carried out using mortar and pestle in the presence of liquid nitrogen. A hybrid TRIzol (Invitrogen)/ RNeasy (Qiagen) protocol was used to isolate total RNA from ground tissue, whereby supernatants from the chloroform phase separation were combined with an equal volume of 100% ethanol and loaded into RNeasy columns for purification. Total RNA quality and concentration was assessed with an Agilent Bioanalyzer 2100. RNA integrity number (RIN) proved to be a poor benchmark of RNA quality, as the G. tigrina 28S rRNA subunit is evidently converted into fragments that co-migrate with 18S rRNA to produce a triple-peak, giving the misleading appearance of RNA degradation. All samples yielded at least 1 ug/ul of RNA when eluted in 40 ul of H20, with an OD A260/A280 of ∼ 2.1 and OD A260/A230 of ∼ 2.2.

Wheeler N.J., Agbedanu P.N., Kimber M.J., Ribeiro P., Day T.A, & Zamanian M. (2015). Functional analysis of Girardia tigrina transcriptome seeds pipeline for anthelmintic target discovery. Parasites & Vectors, 8, 34.

+ Open protocol

+ Expand

Subcellular RNA Fractionation in LPS-Stimulated THP-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

THP-1 cells were stimulated with LPS at 1 μg ml⁻¹ for the length of time indicated. The cells were centrifuged and then split into two equal fractions. Total RNA was extracted from one fraction using the normal Qiagen RNeasy protocol while the other fraction was treated with RLN buffer on ice for 5 min, in order to lyse the plasma membrane while leaving the nuclei intact. The nuclei were then isolated by centrifugation at 300 g in a pre-chilled centrifuge. RNA was then extracted from the nuclear and cytoplasm fractions using the normal Qiagen RNeasy protocol. In order to quantify gene expression within the different fractions by qRT–PCR, the 18S values from the total RNA fraction were used to normalize gene expression across all of the fractions.

IIott N.E., Heward J.A., Roux B., Tsitsiou E., Fenwick P.S., Lenzi L., Goodhead I., Hertz-Fowler C., Heger A., Hall N., Donnelly L.E., Sims D, & Lindsay M.A. (2014). Long non-coding RNAs and enhancer RNAs regulate the lipopolysaccharide-induced inflammatory response in human monocytes. Nature Communications, 5, 3979.

+ Open protocol

+ Expand

Comprehensive RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was collected from iCMs at different days of differentiation using a total RNA isolation kit (RNeasy, Qiagen). Fixed human heart tissue samples were first snap-frozen in liquid nitrogen, homogenized using mortar-pestle and then lysed in Trizol. After tissue debris was separated through centrifugation, the supernatant was mixed with chloroform and shaken vigorously for 30 sec. The solution was then centrifuged following the incubation step for phase separation. RNA was collected from the upper layer formed after centrifugation, using a total RNA isolation kit (RNeasy, Qiagen). RNA purity and concentration were measured on a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific). RNA was converted into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). Validated human gene-specific primers were purchased from Bio-Rad (Supplementary Table 2). iTaq SYBR Green Supermix (Bio-Rad) was used for qRT-PCR reactions and run on CFX Connect 96 Real-Time PCR system (BioRad) in triplicates. The relative expression of genes was quantified by the ΔΔCt method using GAPDH as the housekeeping gene.

Acun A., Nguyen T.D, & Zorlutuna P. (2019). In vitro aged, hiPSC-origin engineered heart tissue models with age-dependent functional deterioration to study myocardial infarction. Acta biomaterialia, 94, 372-391.

+ Open protocol

+ Expand

Quantitative Real-Time PCR of Listerial Virulence Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacterial strains were grown at 37°C with shaking (200 rpm), and at exponential phase (an OD₆₀₀ of 0.6), RNA was extracted using RNeasy QIAGEN and treated with Turbo DNase (Ambion, Invitrogen) to remove contaminating DNA. cDNA was synthesized from approximately 1 μg of RNA using SuperScript III reverse transcriptase (Invitrogen). cDNA generated was used in triplicates or quadruplicates for qRT-PCR using SYBR qPCR supermix (Invitrogen). Primers, used at a final concentration of 0.2 μM, were as follows: hlyA_Fwd: 5′-ggagcaggaggtttcagttgg-3′, hlyA_Rev: 5′-cgcgtggtcccaataagttc-3′, hlyC_Fwd: 5′-ggacttcaggtgatcgtaaatggt-3′, hlyC_Rev: 5′-ctgatggctcggaatagttcatc-3′, gapA_Fwd: 5′-ggccagcatatttgtcgaagttag-3′, gapA_Rev: 5′-ggtgcgaagaaagtggttatgac-3′. gapA was used as a housekeeping control gene. The reactions were performed using ViiA7 Real-time PCR system (Applied Biosystems), and relative transcript levels were normalized to gapA using the ΔΔCt method [65 (link)].

M. V. Murthy A., Phan M.D., Peters K.M., Nhu N.T., Welch R.A., Ulett G.C., Schembri M.A, & Sweet M.J. (2018). Regulation of hemolysin in uropathogenic Escherichia coli fine-tunes killing of human macrophages. Virulence, 9(1), 967-980.

+ Open protocol

+ Expand

Quantitative RT-PCR in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extracted with RNeasy Qiagen columns was treated with DNase (Ambion) and checked with an Agilent Bioanalyser. Reverse transcription was carried out from 2 µg RNA using random hexamers (Promega) and SuperScript III Reverse Transcriptase (Life Technologies). The thermal profile used for PCR on human cells and tissue cDNAs (Clontech) was: 95°C for 20 s, 58°C for 40 s and 72°C for 34 s, 37 cycles.
q-PCR on zebrafish cDNAs was performed in triplicates in 10 µl samples containing 1μl SYBR green reagent, 200 nM oligonucleotides and 1/20 of total cDNA (50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 1 min) using either Amplicon 1 primers zC2orf62_335F (TGGAGCAGTGTTTGTTTGCAG) and zC2orf62_385R (TGCCTGAATCAGACACGGTC) or Amplicon 2 primers zC2orf62_186F (AGCCTGTTGAAGGATTAAGCTGTTA) and zC2orf62_263R (TGAGTTAATTCACTTTCCTCCATGTC).
Relative levels of RNAs were calculated on the basis of ▵CT (Cycle Threshold variation) and normalized to the geometric mean of beta-actin, ef1-alpha[77] (link) and odc1 RNA levels.

Bontems F., Fish R.J., Borlat I., Lembo F., Chocu S., Chalmel F., Borg J.P., Pineau C., Neerman-Arbez M., Bairoch A, & Lane L. (2014). C2orf62 and TTC17 Are Involved in Actin Organization and Ciliogenesis in Zebrafish and Human. PLoS ONE, 9(1), e86476.

+ Open protocol

+ Expand

Extraction and Depletion of Bacterial RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Wild-type MG1655 E. coli cells (a gift from Prof. Paul Babitzke’s lab) were grown overnight in LB broth and pelleted. Cells were treated with the RNAprotect bacterial reagent (Qiagen) to help prevent RNA degradation and then purified by the RNEasy Qiagen kit. A Ribozero kit (Epicentre) was used to deplete rRNAs, which was confirmed by a Bioanalyzer run (Agilent). Ribosomal RNA was depleted to avoid introducing naked rRNA, which is non-physiological.

Hull C.M, & Bevilacqua P.C. (2015). Mechanistic Analysis of Activation of the Innate Immune Sensor PKR by Bacterial RNA. Journal of molecular biology, 427(22), 3501-3515.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using Qiagen RNeasy (Qiagen) and cDNA synthesis were conducted according to the manufacturer’s instructions with Superscript III First-Strand Synthesis SuperMix for RT-PCR (Invitrogen). RT-PCR analysis was conducted in duplicates using Mx3000P (Stratagene) with Fast SYBR Green RT-PCR master mix (BIO-Rad). Averages of the collected data were normalized to β-actin or HPRT. Relative expressions (ΔΔCt) were calculated to the indicated cell population.

Valentine K.M., Davini D., Lawrence T.J., Mullins G.N., Manansala M., Al-Kuhlani M., Pinney J.M., Davis J.K., Beaudin A.E., Sindi S.S., Gravano D.M, & Hoyer K.K. (2018). CD8 follicular T cells promote B cell antibody class-switch in autoimmune disease. Journal of immunology (Baltimore, Md. : 1950), 201(1), 31-40.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!