Deoxyribonucleotide triphosphate

Total RNA was extracted from the macrophages cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed using a 5-minute 65 °C incubation of 1 μg total RNA with deoxyribonucleotide triphosphates (Invitrogen) and random primers (Invitrogen). c-DNA was synthesized using an M-MLV First-Strand Synthesis system (Invitrogen), and used for quantitative analysis of mouse genes (supplemental data) with an SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA). Levels of gene expression were determined by normalization to murine glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

Total RNA was extracted from the macrophages and VSMCs using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. RNA was reverse transcribed using a 5-minute 65 °C incubation of 1 µg total RNA with deoxyribonucleotide triphosphates (Invitrogen) and random primers (Invitrogen). c-DNA was synthesized using an M-MLV First-Strand Synthesis system (Invitrogen), and used for quantitative analysis of mouse genes (Supplementary Table 1) with an SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA). The relative mRNA expression levels were determined by normalization to murine glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using 2[−ΔΔC(T)] method.

The quantitative assay to detect the HCV viral load was performed by an in-house real-time PCR assay that amplified part of the 5′-NCR region (5′ noncoding region) with a sensitivity of approximately 400 IU/mL. Total RNA was extracted from 140 µL of plasma using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) and eluted in 60 µL of elution buffer. cDNA was obtained by a reverse transcriptase reaction using 10 µL of the extracted RNA, 15 ng/µL of random primer (Amersham Biosciences, Piscataway, NJ, USA), and 10 U/µL of Super Script TM III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) in a buffer containing 0.25 U/µL of ribonuclease inhibitor (Invitrogen, Carlsbad, CA, USA) and 0.5 mM deoxyribonucleotide triphosphates (Invitrogen, Carlsbad, CA, USA) (final volume of 20 µL). The reaction was incubated at 45°C for 90 minutes. The cDNA (5 µL) was added to 20 µL of TaqMan Master Mix (Applied Biosystems, Foster, CA, USA) and amplified by real-time PCR using the following primers and probe: HCV_sense, 5′CGTCTAGCCATGGCGTAAGTA3′; HCV_anti-sense, 5′GGTTCCGCAGACCACTATGG3′; HCV_Probe, 5′FAM-CCCCCCTCCCGGGAGA-NFQ-3′. The reaction was performed using the StepOne system (Applied Biosystems, Foster, CA, USA) for 45–50 cycles with the following program: 10 minutes at 95°C, followed by 45 cycles of 15 seconds for 94°C and 60 seconds at 60°C.

Total RNA (1 μg) was reverse-transcribed onto cDNA using iScript cDNA synthesis kit (BIO-RAD Hercules, California, USA). The Real-time PCR (RT-qPCR) was conducted in Quant studio 3 system. For each reaction, the 20 μL mixture contained 5 ng of cDNA, 1× PCR buffer, 2 mM of MgCl₂, 0.2 μm each of the forward and reverse primers, 0.1X of SYBR green (Invitrogen, California, USA), 0.2 mM of deoxyribonucleotide triphosphate (Invitrogen, California, USA), and 0.25 U taq of Platinum Taq DNA Polymerase kit (Thermo Fisher Scientific, Massachusetts, USA). The amplification protocol was as it follows: 94°C for 5 min (1 cycle), followed by 40 cycles at 94°C for 15 s, 60°C for 10 s, and 72°C for 30 s (fluorescence collection). After the amplification step, a thermal denaturing cycle was included to obtain the dissociation curve of the PCR products to verify the amplification specificity. A negative control sample without any cDNA was included in all plates. All analyses were performed with technical duplicates and two to 10 biological replicates. Relative target gene expression level was determined by the comparative cycle threshold (CT) method (29 (link)). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as housekeeping control to normalize variations in the mRNA amount for the target genes.

As described,¹¹ RNA was extracted by trizol reagent (Sigma-Aldrich) at room temperature. Complementary DNA was synthesized from RNA in the presence of oligo (dT) 12-18 (Invitrogen) and deoxyribonucleotide triphosphate (Invitrogen) in a reaction catalyzed by Moloney murine leukemia virus reverse transcriptase (Invitrogen). Relative MYO5B expression level was determined by real-time quantitative polymerase chain reaction using ABsolute aPCR SYBR Green Master Mix (Westburg, Utrecht, Netherlands) in a Step-One Plus Real-Time PCR machine (Applied Biosystems, Waltham, MA). Primers to target MYO5B sequences were TCGGGGTCCTGGACATCTAT (qRT1 forward), CCAGTTTGAAAACATGCGAGTTG (qRT1 reverse), TTGGAAGTGTGGCGATTCAG (qRT2 forward), GCAGTCGGCAGAAGTTGCTT (qRT2 reverse), TCCCCTGAATGAATTTGAAG (qRT3 forward), GGTCATTCCGCTCTTGTAGT (qRT3 reverse).