Smifh2

For formin drug inhibition studies, cells were incubated with 20 or 40 μM SMIFH2 (4401, TOCRIS, UK) in serum containing DMEM for 1–2 h at 5% CO₂, 37 °C. In in vitro experiments, SMIFH2 (340316-62-3, Sigma-Aldrich) was used at a concentration of 100 μM (see below). For myosin II inhibition studies, 30 μM or 50 μM Rho-kinase (ROCK) inhibitor Y-27632 (Y0503, Sigma-Aldrich), or 20 μM S-nitro-blebbistatin (13013-10, Cayman Chemicals) was added for 10–20 min before the experiments or directly during observation. All inhibitors remained in the medium during the entire observation period.

Pharmacological actomyosin-specific reagents, such as the Arp2/3 complex inhibitor CK-666 (Merck Bio-sciences, UK), the formin FH2 domain inhibitor SMIFH2 (Sigma-Aldrich, UK), and the photo-resistant myosin inhibitor Blebbistatin (Milipore) were added to the culture medium at concentrations of 100 μM, 40 μM and 100 μM, respectively. Cells were left to incubate between 30 s and 30 min, as indicated in the corresponding experiment description. Notably, inhibitors were also present at the same concentration in the imaging medium. We could not detect any significant differences in T-cells in the presence of DMSO for the different experimental conditions.

The small-molecule inhibitors were SMIFH2 (Sigma s4826, 60 microM), CK-869 (Sigma C9124, 80 microM) LatrunculinA (Sigma L5163, 0.5 microM), G2 (Xcessbio M60269 for cell treatments, Valuetech custom synthesis for mouse injections). All plasmids were sequence-verified before use and transfected as endotoxin-free maxi preps. siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo). shRNAs were selected among pre-validated Mission pLKO1-shRNA (Sigma) and the corresponding U6-shRNA-cPPT cassettes were subcloned into PB-empty vector^{25 (link)}. Sequences of siRNAs are provided in Table 1.Table 1

siRNA and shRNA sequences.

Target gene	siRNA or shRNA Sequence
hFSCN1 A	UGGCAAGUUUGUGACCUCC
hFSCN1 B	CAGCGUCACCCGUAAGCGC
hCAPZB A	GAAGUACGCUGAACGAGAUck
hCAPZB B	GGAGUGAUCCUCAUAAAGA
AllStars negative control (Qiagen)	Not available—proprietary information
Scramble control shRNA	UUCUCCGAACGUGUCACGU
mFSCN1 A	CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGC TACTAGCGGATGCTTTTTG
mFSCN1 B	CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAG GATAACAGGAGGTTTTTG

To induce EMT in epithelial cells, NBT-II cells were treated in culture medium supplemented with 100 ng ml⁻¹ EGF. For EMT induction in keratinocytes, HaCaT cells were treated in culture medium supplemented with 20 ng ml⁻¹ TGF-β1 (Sigma) and 100 ng ml⁻¹ EGF for 1 day and refreshed with 10 ng ml⁻¹ TGF-β1 and 100 ng ml⁻¹ EGF daily for 3 more days before overnight imaging, or for 4 more days before lysate preparation. To induce chirality in keratinocytes, HaCaT cells were treated with 20–200 nM of latrunculin A (Sigma). For drug inhibition studies, 5–20 nM cytochalasin D (Sigma) or 15 µM SMIFH2 (Sigma) were added to HaCaT cells within 2 h of seeding on micropatterned dishes. For transcriptional inhibition study, cells were treated with 2 µg ml⁻¹ of actinomycin D (Sigma) or pre-treated with 2 µg ml⁻¹ of actinomycin D for 2 h prior to the addition of latrunculin A. All inhibitors remained in the medium during the entire period of observation.

Inhibitor stocks were prepared in DMSO at concentrations of 4 mM for CytoD (Sigma-Aldrich), 10 mM for CK-666 (Sigma-Aldrich), and 3 mM for SMIFH2 (Sigma-Aldrich). Different dilutions of the inhibitors were assessed (1 to 4 μM for CytoD, 100 to 500 μM for CK-666, and 100 to 500 μM for SMIFH2) to determine the appropriate working concentrations that have maximal effects on the actin cytoskeleton (see Fig. S6in the supplemental material) without causing a loss of transepithelial resistance below 500 Ω·cm². At 36 h after MeV-GFP infection, HAE cells were treated apically and basolaterally with final concentrations of 4, 500, and 100 μM for CytoD, CK-666, and SMIFH2, respectively, for 24 h. After treatment, the HAE cells were imaged using an inverted UV fluorescence microscope. The data are presented as means ± the standard deviations of the log-transformed value of individual data points. Statistical significance as adjusted P values between groups was determined by using one-way analysis of variance (ANOVA) with corrections for multiple comparisons.

Mouse monoclonal antibodies to Siglec-1 (Hsn 7D2) and rabbit polyclonal antibodies against cofilin and phospho-cofilin (phospho S3) were obtained from Abcam. Rabbit antibodies against pERM (48G2) and pMLC were purchased from Cell Signaling. Anti-Mouse IgG F(ab) ATTO488 was from Hypermol and Anti-Rabbit IgGF(ab) Cy3 was from Jackson Immunoresearch. Donkey anti-mouse AlexaFluor Plus 488 secondary antibody was from Thermo Fisher. The SIR-Actin Spirochrome Kit (CY-SC001), the Rho Inhibitor I ADP ribosylation of Rho Asn-41 (CT04) and Rho Activator II (CN03) were obtained from Cytoskeleton. The phosphor-ezrin inhibitor NSC668394 was from Calbiochem. The pan-formin inhibitor SMIFH2, the Arp2/3 inhibitor CK-666 and the actin polymerization inhibitor CytoD were purchased from SIGMA. The ROCK inhibitor Y-27632 was obtained from Merk Millipore.