Male C57BL/6J WT and C57BL/6-Tg(CAG-EGFP)1Osb/J mice (Jackson Laboratory, BarHarbor, ME, strain code 003291), aged 8–10 weeks, were used in this study. Mice were fed ad libitum with a normal chow diet (Harlan Teklad, 2018) and randomly assigned to experimental groups. All procedures were conducted under the approval of the University of Kentucky IACUC in accordance with the NIH Guide for the Care and Use of Laboratory Animals (DHHS publication No. [NIH] 85–23, rev. 1996). H9C2 (rat cardiac myoblast) were obtained from ATCC (CRL-1446). HUVEC (human umbilical vein endothelial cells) were obtained from Lonza (C2517A).
C57bl 6 tg cag egfp 1osb j mice
Manufactured by Jackson ImmunoResearch
Sourced in Montenegro
C57BL/6-Tg(CAG-EGFP)1Osb/J mice are a transgenic mouse strain that expresses enhanced green fluorescent protein (EGFP) under the control of the chicken beta-actin promoter and cytomegalovirus enhancer. The EGFP expression is ubiquitous in these mice, allowing for the visualization of cells and tissues.
Automatically generated - may contain errors
Lab products found in correlation
C57bl 6j mice, by Jackson ImmunoResearch (3 mentions)
Human umbilical vein endothelial cells (huvec), by Lonza (1 mentions)
Neutrophil isolation kit, by Miltenyi Biotec (1 mentions)
Phosphate buffered saline (pbs), by Thermo Fisher Scientific (1 mentions)
Ack lysing buffer, by Lonza (1 mentions)
C57bl 6j, by GemPharmatech (1 mentions)
Wild type balb c mice, by Jackson ImmunoResearch (1 mentions)
Apoe mice, by Jackson ImmunoResearch (1 mentions)
Ldlr mice, by Jackson ImmunoResearch (1 mentions)
12 protocols using c57bl 6 tg cag egfp 1osb j mice
1
Murine Cardiac and Endothelial Cell Study
2
Isolation of Neutrophils from Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bone marrow of C57BL/6-Tg(CAG-EGFP)1Osb/J mice (The Jackson Laboratory), which have widespread enhanced green fluorescent protein (eGFP) fluorescence, with the exception of erythrocytes and hair, was collected from femur and tibia in phosphate-buffered saline (Thermo Fisher Scientific). After filtration through a 70-μm cell strainer the cell suspension was centrifuged for 5 minutes at 300 × g and the obtained cell pellet was incubated with ACK lysing buffer (BioWhittaker, Walkersville, MD) for 1 minute to remove red blood cells. The neutrophils were isolated by magnetic activated cell sorting using a Neutrophil Isolation Kit (Miltenyi Biotec, San Diego, CA) according to the manufacturer’s instructions.
3
Genotyping Transgenic Mouse Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All procedures were conducted in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and approved by the Institutional Care and Use Committee of the Stanley Manne Children's Research Institute. Animals were kept under a 12-hour light/dark cycle. GAD65 transgenic mice: Four male and three female NOD 129X1-Gad2tm1Bae/J heterozygous mice (GAD65+/-) were obtained from Jackson Laboratory (#003653, Bar Harbor, ME). GAD65-/- mice had been generated by inserting a neomycin resistance cassette into exon 1 of the Gad65 gene downstream of the translation initiation start site. GAD65-/-, GAD65+/- and GAD65+/+ mice were generated from heterozygous breeding and offspring were genotyped by PCR. PCR generated a 315 bp fragment from exon 1 of the Gad65 gene using primer set oIMR 3457 5’- CATACGCAGACAGCACGTTT-3’ & oIMR 3473 5’- CAAACCCTAAACCACCCACA-3’ and a 530 bp neo gene using oIMR 3457 & oIMR 297 5’- CACGAGACTAGTGAGACGTG –3’ . C57BL/6-Tg(CAG-EGFP)1Osb/J mice (Jackson Labs) were crossed to generate E13.5 embryos for GFP+ medial ganglionic eminence (MGE) cells.
4
Melanoma Xenograft Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For studies using the B16F10 melanoma cell lines, female C57BL6/J mice were used (Jackson Laboratories, Bar Harbor, ME). Mice were injected with tumor cells at 7–8 weeks of age. For engraftment of human melanoma cells, we used female NSG mice (7–8 weeks of age) provided by the mouse phase I unit at UNC. C57BL/6-Tg (CAG-EGFP)1Osb/J mice were purchased from Jackson Laboratories, Bar Harbor, ME). Pecam1 knockout mice were kindly provided by Dr. E. Tzima (UNC Chapel Hill), and tumor cells were engrafted in female mice at 7–8 weeks of age. All mouse experiments were carried out in accordance with protocols approved by the Institutional Animal Care and Use Committee at the University of North Carolina at Chapel Hill.
5
Leukocyte Homing Assay in Mouse Atherosclerosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The leukocyte homing assay was performed as described previously (4 (link)). Peritoneal exudate cells were stimulated by an intraperitoneal injection of 4% thioglycolate into male C57BL/6-Tg (CAG-EGFP)1Osb/J mice (the Jackson laboratory) aged 8 weeks. After 2 days, three million cells were injected intravenously into DKO-GFP or DKO-MYDGF mice that had been fed a WD for 12 weeks. After 2 days, aortic roots were embedded in OCT (optimal cutting temperature). Total fluorescent cells were counted in 10 × 8-mm sections over a 0.5-mm area, and the cell number was normalized to plaque area.
6
Liver Fibrosis Mouse Model Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 J and B6/JGpt-Ccr2em8Cd6657/Gpt were obtained from GemPharmatech. C57BL/6J-TgN (Chicken-β-actin-LUC) ZLFILAS mice were obtained from Shanghai Sciencelight Biology Science&Technology. C57BL/6-Tg (CAG-EGFP) 1Osb/J mice were obtained from the Jackson Laboratory. All mice were housed under standard conditions as previously described [20 (link)]. The 8- to 12-week-old and sex-matched mice were used for the experimental procedures. For liver fibrosis models, mice were intraperitoneally injected with CCl4 (1 mL/kg; 1:10 [v/v] in olive oil, Sangon Biotech) twice a week for 4 weeks. The animals were sacrificed 72 h after the final CCl4 injection, and serum and whole livers were collected for biochemical, histological, and molecular analyses as previously described [31 (link)]. For the transplantation experiment, mice were treated with CCl4 for 4 weeks with eight injections, and 1 × 106 BM-MSCs were transplanted into mice 24 h after the final injection. The mice were then continually injected with CCl4 for another week until use. All animal experiments were performed in accordance with legal regulations and approved by a local ethics committee.
7
CXCR2 Knockout Mice for Immunological Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CXCR2 knockout (BALB/C‐Cxcr2tm1Mwm) mice, BALB/C wild‐type mice, and C57BL/6‐Tg[CAG‐EGFP]1Osb/J mice were obtained from the Jackson Laboratory (Bar Harbor, ME). C57BL/6J wild‐type male mice (8‐ to 10‐week old; 22–25 g) were purchased from Orient, Co., Ltd. (Gapyeong, Republic of Korea). All animals were housed in an air‐conditioned facility (22°C–25°C; relative humidity 50%–65%) and provided a laboratory diet and water. Animal treatment and maintenance were performed in accordance with the Principles of Laboratory Animal Care, and animal experiments were performed using protocols approved by the Pusan National University Institutional Animal Use and Care Committee (PNU‐2016‐1381).
8
Syngeneic Murine Transplantation Model
9
Full-Thickness Skin Defect Repair in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-thickness skin defects were prepared in CD1 nu/nu mice (age: ~3 months, body weight: 30–32 g). Ad-MVF were isolated from C57BL/6-Tg(CAG-EGFP)1Osb/J mice (age: 7–12 months, body weight: >30 g; The Jackson Laboratory, Bar Harbor, ME, USA)40 (link). The animals were housed under a 12 h light/dark cycle and received water and standard food pellets (Altromin, Lage, Germany) ad libitum.
All experiments were approved by the local governmental animal care committee (Landesamt für Verbraucherschutz, Saarbrücken, Germany; permit number: 25/2016) and conducted in accordance with the European legislation on the protection of animals (Directive 2010/63/EU) and the National Institutes of Health (NIH) guidelines on the care and use of laboratory animals (NIH publication #85–23 Rev. 1985).
All experiments were approved by the local governmental animal care committee (Landesamt für Verbraucherschutz, Saarbrücken, Germany; permit number: 25/2016) and conducted in accordance with the European legislation on the protection of animals (Directive 2010/63/EU) and the National Institutes of Health (NIH) guidelines on the care and use of laboratory animals (NIH publication #85–23 Rev. 1985).
10
Murine Model of C57BL/6 Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 (8–12 weeks old) male mice were obtained from Fourth Military Medical University. C57BL/6-Tg (CAG-EGFP)1Osb/J mice (stock No: 003291) were purchased from “The Jackson Laboratory”. Housing and experimental animal procedures were approved by Animal Experimentation and Ethics Committee of Fourth Military Medical University.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!