The largest database of trusted experimental protocols

Goscript reverse transcription kit

Manufactured by Thermo Fisher Scientific
Sourced in United States

The GoScript Reverse Transcription kit is a tool used for the conversion of RNA to complementary DNA (cDNA) in a laboratory setting. It provides the necessary components to perform reverse transcription, a crucial step in various molecular biology applications, including gene expression analysis, RNA sequencing, and cDNA library construction.

Automatically generated - may contain errors

3 protocols using goscript reverse transcription kit

1

Quantification of Ankle Joint mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from ankle joint tissues using the RNeasy Mini Kit (Qiagen, USA) according to the manufacturer’s protocol. The RNA was reverse-transcribed into cDNA using the GoScript Reverse Transcription kit (Thermo, USA) according to the manufacturer’s protocol. The mRNA levels were quantified by RT-qPCR using an SYBR Green qPCR Master Mix (Takara, Dalian, China) for 40 cycles on the StepOnePlus RT-PCR system (Applied Biosystems). The primer sequences used to amplify mRNA were shown in Table 1. The levels of mRNA expression were normalized to the reference gene (GAPDH).

Sequences of Primers Used in This Research

GeneForward PrimerReverse Primer
CAT5ʹ-CCTGCAACGTTCTGTAAGGC-3’5ʹ-ATATCAGGTTTCTGCGCGGC-3’
GPx-15ʹ-CTCATGACCGACCCCAAGTT-3’5ʹ-GTCAGAAAGCGACGGCTGTA-3’
IL-65ʹ-TGTATGAACAACGATGATGCAC-3’5ʹ-CTGGCTTTGTCTTTCTTGTT-3’
TNF-α5ʹ-CTTCTGTCTACTGAACTTCGGG-3’5ʹ-CAGGCTTGTCACTCGAATTTTG-3’
GAPDH5ʹ-TCGGAGTGAACGGATTTGGC-3’5ʹ-TGACAAGCTTCCCGTTCTCC-3’
+ Open protocol
+ Expand
2

Quantification of GLUT4 and IRS1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cells and muscle with Trizol regent (SolarBio Life Science, Beijing, China) and treated with DNaseI (Promega, Madison, WI, USA). About 1.5 μg total RNA was reverse‐transcribed into cDNA using GoScript Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). Each 1 μL of the synthesized cDNA was used as a template for real‐time PCR analysis with the GoTaq qPCR kit (Promega) according to the manufacturer's instructions. PCR was performed using the Applied Biosystems 7500 Real‐Time PCR System (Thermo Fisher Scientific) as follow: 94 °C for 15 min; 40 cycles of 94 °C for 15 s, 60 °C for 60 s; and 72 °C for 10 min. The results were analyzed by the relative quantitative (2ΔΔCT) method. The primer sequences were as follows:

GLUT4 forward primer: 5′‐GGTTGGTGCCTATGTATGT‐3′,

reverse primer: 5′‐CGGATGATGTAGAGGTATCG‐3′;

IRS1 forward primer: 5′‐AATAGCCGTGGTGATTACAT‐3′,

reverse primer: 5′‐CAGAAGCAGAAGCAGAGG‐3′;

β‐actin forward primer: 5′‐TGTTGTCCCTGTATGCCTCT‐3′,

reverse primer: 5′‐TAATGTCACGCACGATTTCC‐3′.

+ Open protocol
+ Expand
3

Immunohistochemical Analysis of Apollon Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rabbit polyclonal anti-Apollon antibodies were purchased from Abcam (cat. nos. ab84429 and ab19609; Cambridge, UK); the PV-6001 two-step immunohistochemistry kit (cat. no. PV-6001) was from OriGene Technologies, Inc. (Beijing, China); Invitrogen® TRIzol reagent (cat. no. 15596026) was from Thermo Fisher Scientific, Inc. (Waltham, MA, USA); the GoScript Reverse Transcription kit (cat. no. A5001) was from Promega Corporation (Madison, WI, USA); the GoTaq RT-qPCR kit (cat. no. A6001) was from Promega Corporation; paraffin-embedded machines, the paraffin slicing machine and the automatic upright microscope system (DM5000 B) were from Leica Microsystems (GmbH, Wetzlar, Germany); the 400W UV imaging system was from Kodak (Kodak, Tokyo, Japan); and the ABI PRISM 7500 PCR applications were purchased from Thermo Fisher Scientific, Inc.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!