Cfx96 real time system cycler

RNA was harvested from 10 × 10⁶ MDA-MB-231 cells that were mock treated or treated with 100 ng/ml cmvIL-10 or hIL-10 for 5 h using the RNeasy Midi Kit and RNAse-Free DNase set (Qiagen, Valencia, CA). From the isolated RNA, cDNA was prepared using the RT² First Strand Kit (SA Biosciences, Frederick, MD) and subsequently loaded into a 96-well breast cancer metastasis profiler PCR array (PAHS-028ZD) with system RT² SYBR Green Mastermix (SA Biosciences). The plates were run using the CFX96 Real-Time system cycler (BioRad, Hercules, CA) with the following amplification program: 95 °C for 10 min, 95 °C for 15 min with a slow ramp rate for 1.0 c/s and 60 °C for 1 min. The data from three biological replicates for each treatment was analyzed by the ΔΔCT method according to manufacturer’s instructions using the RT² profiler PCR array data analysis program located on the SABiosciences web portal and is reported as fold change relative to control.

Primers used for qRT-PCR are: ACT8 qRT fw: TGAGACCTTTAATTCTCCAGCTATG; ACT8 qRT rv: CCAGAGTCCAACACAATACCG; PR1 qRT fw: GATGTGCCAAAGTGAGGTGTAA; PR1 qRT rv: TTCACATAATTCCCACGAGGA; PDF1.2 qRT fw: GTTCTCTTTGCTGCTTTCGAC; PDF1.2 qRT rv: GCAAACCCCTGACCATGT. Total RNA was extracted from leaves before and 12 h (hpi) and 1, 2, 3, and 5 days (dpi) post mildew inoculation. Leaves were collected from at least five individual plants and total RNA was extracted with a NucleoSpin RNA plant kit (Machery-Nagel) and 2 μg of total RNA was reverse-transcribed with an oligo-dT primer and M-MulV Reverse Transcriptase (Fermentas) following the manufacturers' instructions. Quantitive real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad) in a CFX96 Real-Time System Cycler (Bio-Rad). A 50-cycle two-step amplification protocol (10 s at 95°C, 25 s at 60°C) was used for all measurements.

RT-qPCR analysis was performed on equal amounts of cDNA from control and stressed samples, using SYBR Green fluorescent detection in a CFX96 Real-Time System Cycler (Bio-Rad, Hercules, CA, USA), with three biological replicates per variety and treatment. The primer sequences used are reported in Table S1. β-tubulin (CiTUB, KP752084) (PCR program: 10 min at 95 °C; 40 cycles of 15 s at 95 °C; 20 s at 57 °C) and actin (CiACT, KP752080) (PCR program: 10 min at 95 °C; 40 cycles of 15 s at 95 °C; 20 s at 59 °C) were tested as reference genes [48 (link)]. For CiXTH29, the PCR program was as follows: 10 min at 95 °C; 40 cycles of 15 s at 95 °C; 20 s at 57 °C. For CiLEA4, primer pair (Table S1) previously reported for CsLEA4 [49 (link)] was used for RT-qPCR analysis, with the following program: 10 min at 95 °C; 40 cycles of 15 s at 95 °C; 20 s at 57 °C. The specificity of PCR products was checked in a melting-curve test. The PCR product was sequenced and compared with other sequences using the NCBI BLAST web tool (accessed on 15 December 2021) (Figure S2) confirming that CiLEA4’s identity with AtLEA4 was 98%. Gene expression differences between mock and stressed samples were considered significant when gene expression was at least doubled (greater than or equal to two-fold up-regulation) or halved (less than or equal to two-fold downregulation), according to [50 (link)].