Rabbit primary antibody

Various signaling targets (MAPKs, NFκB, NLRP3) were analyzed using total protein extracts prepared from control (vehicle only) and treated [(EO alone or LPS alone or EO+LPS) or (cineole alone or cineole +LPS)] cells. The cells were lysed (coinciding with 30 minutes or 4 hours post-LPS addition as described above) using radio immunoprecipitation assay (RIPA) buffer (20 mM tris.HCl pH 7.5, 1 mM EDTA, 1% nonidet P-40, 0.1% sodium deoxycholate, 2.5mM sodium pyrophosphate, 150 mM NaCl) supplemented with protease and phosphatase inhibitors. Protein extracts from different treatments were resolved on a 12% SDS-PAGE gel and analyzed by Western blot analysis using total- and phospho- antibodies for MAPKs (p38, JNK, ERK) and NFκB and antibodies for NLRP3 using ECL kit (Pierce Chemical, Rockford, IL, USA). Primary rabbit antibodies (Cell Signaling Technology, Danvers, MA, USA) were used at a dilution of 1:1000 for all test targets, including MAPKs (p38 or p-p38, SAPK/JNK or p-SAPK/JNK, p44/42/ERK/1/2), NFκB, and NLRP3, whereas the β- Actin antibody (Sigma, USA) was used at a 1:4000 dilution. HRP-conjugated anti-rabbit IgG secondary antibody (Sigma, USA) was used at a 1:4000 dilution. Bands were visualized using ECL kit (Pierce Chemical, Rockford, IL, USA) and quantified using NIH Image J software.

Primary antibodies including: Nf-kB (P65) (65 kDa), iNOS (130 kDa), Foxo1 (78 kDa), PPAR-γ (53 kDa), Gsk3β (46 kDa), and Actin (45 kDa) along with secondary antibodies were acquired from Cell Signaling Technology, Danvers, MA, USA. Pancreatic tissue is homogenized with T-PER (tissue-protein extraction lysis solution) (50 mg/500 µL lysing solution) along with 10 µL protease inhibitor cocktail and 10 µL phosphatase inhibitor to yield protein lysates. Homogenization was done under ice and centrifuged at 10,000× g for 5 min to collect the debris. Quantification of protein was done by Bradford assay and 40 µg of protein was loaded into the SDS-PAGE and later, samples were transferred to the nitrocellulose membrane by using Bio-Rad Transblot turbo transfer system. After transfer, membrane was blocked by using 5% Bio-Rad blocking reagent and incubated with 1:1000 dilution primary rabbit antibodies (Cell Signaling Technology, USA) for 12 h at 4 °C. The membrane was washed after treatment with TBST and blots were incubated with peroxidase conjugated secondary antibody (1: 20,000) treatment for an hour. Using the chemiluminescence document reader, after addition of Immobilon Western chemiluminescent HRP substrate at standardized exposure time, bands were observed. Analysis of samples were done by densitometry analysis compared to β-Actin (Major Science image analysis software)

Protein lysates were obtained by homogenizing the pancreatic and brain tissues (whole brain tissue) with T-PER (Tissue-protein extraction lysis solution) (50 mg/500 μl lysing solution) along with 10 μl protease inhibitor cocktail and 10 μl phosphatase inhibitor. Homogenization was done under ice and centrifuged at 10,000×g for 5 min to collect the debris. Protein quantification was done by Bradford assay and 40 μg of protein was loaded into the SDS-PAGE. The separated protein samples were transferred to the nitrocellulose membrane by using Bio-Rad Transblot turbo transfer system. After transfer, membrane was blocked by using 5% Bio-Rad blocking reagent. Blocked membrane was incubated with 1:1000 dilution primary rabbit antibodies (Cell Signaling Technology, USA) for 12 h at 4 °C. After treatment, the membrane washed and incubated with secondary antibody (1: 20,000) treatment for an hour. Bands were observed in the chemiluminescence document reader, after addition of Immobilon Western chemiluminescent HRP substrate at standardized exposure time. Bands of the two groups were analyzed by densitometry analysis compared to β-Actin (Major Science image analysis software).

Subcutaneous tumors driven by D8-175 cell line were isolated, cryogrinded and lysed in 1x RIPA buffer with protease and phosphatase inhibitor (Thermo Scientific) for 30 minutes on ice. The whole-cell lysates were then clarified by centrifugation for 25 minutes at 15,000 rpm at 4° C. Protein concentrations were determined using the BCA Protein Assay Kit (Pierce). Equal amounts (30 μg) of protein samples were fractionated by a Novex^® 4–20% Tris-Glycine gel (Thermo Scientific), transferred to nitrocellulose membranes (Thermo Scientific), and blocked in Odyssey blocking buffer (LI-COR Biosciences). KRAS was probed by primary rabbit antibody (1:1000) (Cell Signaling, #3965), and actin was stained using primary rabbit antibody (1:1000) (Abcam, ab8227). The desired bands were detected by labeling with anti-rabbit (1:10,000) IgG-IRDye 680 secondary antibodies and visualized using the Odyssey Infrared Imaging System (LI-COR Biosciences).

In order to reveal differentiation, cells were stained in the collagen networks after 6 d. Cells were fixed with 4% paraformaldehyde (Carl Roth, Karlsruhe, Germany) and permeabilized with 0.1% Triton X-100 (Carl Roth). Cell nuclei were stained with DAPI (Invitrogen, Karlsruhe, Germany). Cytoskeletal actin was stained with Alexa 488-Phalloidin (Invitrogen) to investigate cell morphology and to prove co-alignment of F-actin and αSMA. Staining of Smad2/3 was done with a primary rabbit antibody (Cell Signaling Technology, Leiden, Netherlands) and subsequently donkey anti-rabbit IgG-CFL 488 antibody (0.4 mg/ml, Santa Cruz Biotechnology, Heidelberg, Germany). Staining of αSMA was achieved with efluor660 conjugated antibody (0.2 mg/ml, ebioscience, Frankfurt, Germany). Antibody staining was performed according to the manufacturer’s instructions.
For imaging coverslips were turned over and cell-laden networks placed face down in a 24-well plate with glass bottom (#1.5, deviation ± 5 µm, Greiner Bio-One) on a confocal laser scanning microscope (cLSM; LSM 700, Carl Zeiss, Jena, Germany) with 20×/0.8 Plan-Apochromat objective (Carl Zeiss). Imaging was performed deep in the collagen network at the level of the µ-beads. Cells remaining on the collagen matrix surface were excluded from imaging and subsequent analysis.

SOCS3 and non‐silencing shRNA GIPZ lentiviral constructs were purchased from Thermo Scientific (Waltham, MA) and were used to produce a SOCS3 knockdown and control HIEC cell lines. Each construct contained a puromycin resistance marker. HIEC cells were seeded at a concentration of 2 × 10⁴/well and were incubated with the respective lentivirus, according to manufacturer's instructions. Medium containing 1.35 μg/ml of puromycin was used to maintain transduced HIEC cells during culture and removed during experiments. Cells containing the SOCS3 (SOCS3^Low) and non‐silencing constructs (SOCS3^Ev Ev‐Empty vector) were validated for SOCS3 mRNA (using qRTPCR) and protein. SOCS3^Low demonstrated a 60% ± 4 decrease in SOCS3 mRNA compared with SOCS3^Ev cells SOCS3 (95 bp) Forward: TCGATTCGGGACCAGCCCCC and Reverse: GAGCCAGCGTGGATCTGCG. SOCS3^Low cells showed an 87% ± 8 decrease in SOCS3 protein compared with SOCS3^Ev (rabbit primary antibody, Cell Signaling no. 2923).

Immunostaining was performed on 2 μm thick sections, from paraffin-embedded, formalin-fixed tissue blocks of breast cancer derived sample of the patient mounted on positively charged glass. They were incubated with Phospho-AKT-Ser473 Rabbit primary antibody (Cell Signaling Technology, Inc. Danvers, MA) and PTEN Rabbit primary antibody (Zymed Laboratories, Invitrogen, Paisley, UK).