Qscript flex cdna synthesis kit

One of the virus isolates (from sample 10, 1st passage on LFBK-αvβ6 cells) was used for whole genome sequencing. Total RNA was extracted from the culture supernatant and used for sequence-independent single-primer amplification by a previously described method [13 (link)] with small modifications. First, cDNA was prepared with the qScript Flex cDNA Synthesis Kit (Quantabio, Beverly, MA, USA) and the K-8N primer (5′ GACCATCTAGCGACCTCCACNNNNNNNN 3′), from which dsDNA was synthesized with the same primer and the Klenow fragment of E. coli DNA Polymerase I (New England Biolabs, Ipswich, MA, USA). The dsDNA was purified with sparQ PureMag beads (Quantabio) and used as the template for PCR amplification with Phusion High-Fidelity polymerase and the K primer (5′ GACCATCTAGCGACCTCCAC 3′). The PCR product was cleaned up with a QIAEX II column (Qiagen), quantified with the QuantiFluor dsDNA system (Promega, Madison, WI, USA) and submitted to Eurofins, Constance, Germany for Ilumina paired-end sequencing.

Total RNA was isolated using RNAbee (Tel-Test) from approximately 2,000 adult hermaphrodite worms synchronized by bleaching technique at the ages indicated in the corresponding figures. Sample size was determined according to our previous publications^{8 (link),42 (link)}. cDNA was generated using a qScript Flex cDNA synthesis kit (Quantabio). SybrGreen real-time qPCR experiments were performed with a 1:20 dilution of cDNA using the CFC384 Real-Time System (Bio-Rad). Data were analysed with the comparative 2ΔΔC_t method using the geometric mean of cdc-42, pmp-3 and Y45F10D.4 as housekeeping genes^{55 (link)}. qPCR experiments were not blinded. See Supplementary Table 13 for details about the primers used for quantitative RT–PCR.

Reverse transcription for miRNAs was performed with a qScript flex cDNA synthesis kit (Quantabio, Beverly, MA, USA) according to Androvic et al. [47 (link)] in the total reaction volume of 10 µL. RNA was diluted in TE-LPA buffer (TE buffer with linear polyacrylamide at a final working concentration of 20 µg/mL). The RT reaction mixture contained 10 ng of total RNA, 1 × RT buffer, 0.05 µM RT primer, 1 µL GSP enhancer, and 0.5 µL RT enzyme. RT reactions were incubated in PCR tubes for 45 min at 25 °C and for 5 min at 85 °C and then held at 4 °C.