Mirna rt kit

Total RNA was extracted from glioma tissues and glioma cell lines (80–90% confluence) using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Following extraction, the RNA and miRNA samples were reverse transcribed into cDNA using a RevertAid RT kit (Thermo Fisher Scientific, Inc.) or miRNA RT kit (Tiangen Biotech Co., Ltd.), respectively. The reverse transcription reaction condition was as follows: 37°C for 15 min, 85°C for 5 sec and 4°C for 2 min. The cDNA templates were amplified by qPCR using SYBR Green Mix (Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used for the qPCR: Initial denaturation at 95°C for 55 sec, 40 cycles of 95°C for 22 sec and 60°C for 44 sec. mRNA levels were quantified using the 2^−ΔΔCq method (12 (link)). GAPDH was used as an internal control for lncRNAs and miRNA samples were normalized to U6 expression. The following primers were used for the qPCR: MT1JP, forward: 5′-TACCGAGCTCGGATCCTTGCGGTCTCTCCATTTATCG-3′, reverse: 5′-TACCGAGCTCGGATCCTTGCGGTCTCTCCATTTATCG-3′; GAPDH, forward: 5′-GCACCGTCAAGGCTGAGAAC-3′, reverse: 5′-TGGTGAAGACGCCAGTGGA-3′. U6 forward, 5′-CTCGCTTCGGCAGCACA3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′. The aforementioned primers were designed and synthesized by Shangai GenePharma Co., Ltd. (Shanghai, China).

TRIzol^® reagent obtained from Invitrogen; Thermo Fisher Scientific, Inc. was employed for total RNA extraction in accordance with the manufacturer's guidelines. Following the measurement of the concentration and purity of RNA specimens, RT was performed to synthesize cDNA specimens with U6 and GAPDH as the internal reference. A PCR solution was prepared with a premixed solution containing forward (F)/reverse (R) primers, DEPC from Beyotime Institute of Biotechnology, SYBR Green from Applied Biosystems; Thermo Fisher Scientific, Inc., and templates. Subsequently, the prepared solution was placed on an RT-PCR instrument for PCR amplification. miRNAs underwent RT into cDNAs with the use of a miRNA RT Kit from Tiangen Biotech Co., Ltd. and then subjected to PCR and quantitative analysis on the basis of the instructions of the miRNA qPCR kit from the same company. The primer sequences were as follows: lnc-NEAT1 F, TGTCCCTCGGCTATGTCAGA and R, GAGGGGACGTGTTTCCTGAG; GAPDH F, TGACCACAGTCCATGCCATCAC and R, GCCTGCTTCACCACCTTCTTGA; miR-638 F, AAGGGATCGCGGGCGGGT and R, CAGTGCAGGGTCCGAGGT; and U6 F, CTCGCTTCGGCAGCACATATACTA and R, ACGAATTTGCGTGTCATCCTTGC.