The largest database of trusted experimental protocols

Step one plus or 7500 fast systems

Manufactured by Thermo Fisher Scientific
Sourced in Japan

The Step One Plus or 7500 Fast systems are real-time PCR instruments designed for nucleic acid detection and quantification. The systems provide accurate and reliable performance for a variety of applications in life science research.

Automatically generated - may contain errors

2 protocols using step one plus or 7500 fast systems

1

Gene Expression Analysis in Bone Healing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Since the tooth sockets of mouse upper molar tooth are very small, we used the left maxilla including extraction sockets for RNA isolation. In the semistabilized femoral fracture model, the whole femur including fracture site was subjected to RNA isolation as described previously (Mohan et al., 2005 (link)). Total RNA was isolated from these bones as previously described (Yang et al., 2017 (link)). The maxilla and femur samples were dissected on days 0, 3, 5, and 7 after the operation. Quantitative real-time PCR was performed by using the One-Step SYBR Prime Script PLUS RT-PCR (TAKARA, Shiga, Japan) using Step One Plus or 7500 Fast systems (Thermo Fisher Scientific). The mRNAs examined were Sp7 (Osterix), Col1a1 (type I collagen), Runx2, Sox9, Acan (Aggrecan), Col2a1 (type II collagen), and Col10a1 (type X collagen). Relative expression was determined using Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. Expression levels were calculated as fold-change relative to control group (0 days), which were isolated immediately after the operations. The primers used for each gene are shown in Table 1 in Supplemental information.
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR of Bone Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse femora or molars were homogenized in TRIzol reagent (Thermo Fisher Scientific) using Tissue Lyser (Qiagen, Hilden, Germany), and total RNA was purified using the PureLink RNA Micro kit (Thermo Fisher Scientific). Quantitative Real-Time PCR was performed by using the One Step SYBR Prime Script PLUS RT-PCR (TAKARA, Shiga, Japan) using StepOnePlus or 7500 Fast systems (Thermo Fisher Scientific). Gene expression data were normalized to Gapdh or Col1a1 expression. The primers for each gene are shown in Table 1.

Primers used for Real-time PCR.

GeneForward (5′–3′)Reverse (5′–3′)
Csf-1GAACAGCCTGTCCCATCCATCTGAGGCCAGCTCAGTGCAA
RanklCATGTGCCACTGAGAACCTTGAACAGGTCCCAGCGCAATGTAAC
OpgCATGAGGTTCCTGCACAGCTTCACAGCCCAGTGACCATTCCTAGTTA
F4/80GAGATTGTGGAAGCATCCGAGACGACTGTACCCACATGGCTGATGA
Csf-1rGGCCCAGCCTGTATTTGCACACCGCTGCTTGGCAGGTTAG
Col1a1TCAGTGCAATTGTGTTGCTGAAAGGATACCAAACTGGGCGTGCTG
GapdhTGTGTCCGTCGTGGATCTGATTGCTGTTGAAGTCGCAGGAG
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!