The P. multocida P0910 strain used in this study was isolated from dead yaks in Qilian County, Qinghai Province. Pasteurella multocida was cultured in Trypticase Soy Broth (TSB) at 37 °C under constant shaking and the concentration of the bacterial solution was determined by plate counting. E. coli DH5α competent cells were purchased from Sangon (Sangon Biotech, Shanghai, China). E. coli DH5α recombinant strains were screened on plates of Luria–Bertani (LB) medium supplemented with 100 μg/mL ampicillin. The pEX18AP plasmid was obtained from Dr Qingmin Wu, China Agricultural University.
E coli dh5α competent cells
Manufactured by Sangon
Sourced in China
E. coli DH5α competent cells are a laboratory strain of Escherichia coli bacteria that are commonly used as a host for various molecular biology applications. These cells are genetically modified to be highly efficient at taking up and maintaining plasmid DNA, making them a valuable tool for DNA cloning, transformation, and other genetic engineering experiments.
Automatically generated - may contain errors
Lab products found in correlation
Puc18 t vector, by Sangon (1 mentions)
5 aza 2 deoxycytidine, by Merck Group (1 mentions)
Geneticin g418, by Selleck Chemicals (1 mentions)
Endofree midi plasmid kit, by Tiangen Biotech (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Yeasen (1 mentions)
Pncmo2, by Takara Bio (1 mentions)
E coli dh5α cells, by Thermo Fisher Scientific (1 mentions)
Pmd19 t, by Takara Bio (1 mentions)
Neomycin, by Solarbio (1 mentions)
4 protocols using e coli dh5α competent cells
1
Isolation and Characterization of P. multocida
2
Bisulfite Sequencing of miR-608 CpG Islands
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate the methylation state of CpG‐islands close to miR‐608 transcription start site (TSS) in PCa cells, bisulfite sequencing PCR (BSP) was utilized. Forward primer 5′‐TATTTTATTTTTTAAGTTGGGTTAGG‐3′ and reverse primer 5′‐CCCTCCAACATCCTAAACAATC‐3′ were adopted to amplify the identified CpG‐island DNA sequence. Amplified PCR products were isolated, purified, and inserted into pUC18‐T vectors constructed by Sangon. Correct insertion of the CpG‐island sequence was verified by blue‐white screen of E.coli DH5α competent cells (Sangon), and 10 positive single colonies were sequenced by BSP (Sangon).
PC3 cells were treated with 5 μmol/L 5‐aza‐2′‐deoxycytidine (Sigma Aldrich) for 72 hours. Later RNA of PC3 cells was extracted and miR‐608 was quantified as per the section qRT‐PCR.
PC3 cells were treated with 5 μmol/L 5‐aza‐2′‐deoxycytidine (Sigma Aldrich) for 72 hours. Later RNA of PC3 cells was extracted and miR‐608 was quantified as per the section qRT‐PCR.
3
Lentiviral Overexpression and Knockdown of Key Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flag-CRIP1, empty vector and shRNA plasmids were purchased from Youbio Biological Technology (Changsha, China). The full-length coding sequence of CRIP1 was inserted into pCDH-EF1-MCS-T2A-Puro. shRNAs targeting CRIP1, PSME4 and USP7 were purchased from OBiO Technology (Shanghai, China). Endotoxin-free transfection-grade plasmid DNA was amplified in E. coli DH5α Competent Cells (Sangon Biotech, Shanghai, China) and purified with the EndoFree Midi Plasmid Kit (TIANGEN, Beijing, China). Lentiviruses were constructed using psPAX2 and pMD2G and transfected into HEK293T cells with Lipofectamine 3000 (Invitrogen, USA), harvested after 48 or 72 h, and concentrated through ultracentrifugation (20,000×g, 2.5 h, 4 °C). The lentivirus was added to 1 106 cells along with 8 mg/mL polybrene in a 12-well plate, and stable cells were selected after 72 h using puromycin (60210es25, Yeasen, China) and geneticin (G418; Selleck, USA). The levels of CRIP1 were confirmed using RT-qPCR and western blotting. shRNA sequences are listed as follows: CRIP1-shRNA (5′-AGCACGAAGGCAAACCCTACT-3′); PSME4-shRNA (5′-GCAACTAGTAAATCTCTTTGC-3′); and USP7-shRNA (5′-GTGTCCTATATCCAGTGTAAA-3′).
4
Cultivation and Manipulation of B. choshinensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B. choshinensis strain HB116 (Takara Bio, Inc.) was used in this study. E. coli DH5α competent cells (Sangon Biotech Co, Ltd.) were used for DNA manipulation. pNCMO2 (Takara Bio, Inc.) and pMD19-T (Takara Bio, Inc.) were used as the vector and subcloning plasmid, respectively. Milk-Tween (MT) medium containing 2% yeast extract, 10% glucose, 10% polypeptone, 5% meat extract, 0.01 % FeSO4·7H2O, 0.001% ZnSO4·6H2O and 0.01% MnSO4·4H2O was used to culture strain HB116. E. coli DH5α cells were cultured in Luria Broth medium (Oxoid; Thermo Fisher Scientific, Inc.). NaOH was used to adjust the pH of all media to 7.0. Neomycin (20 µg/ml; Beijing Solarbio Science & Technology Co, Ltd.) was added to the media used to culture bacteria containing pNCMO2 and derivatives.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!