Sacii restriction enzyme

Manufactured by New England Biolabs

SacII is a type II restriction enzyme that recognizes and cleaves the palindromic DNA sequence 5'-CCGC↓GG-3'. It is commonly used in molecular biology applications such as DNA cloning, genomic analysis, and genetic engineering.

Automatically generated - may contain errors

Lab products found in correlation

Sp6 rna polymerase, by New England Biolabs (1 mentions) Pcr cleanup kit, by Qiagen (1 mentions) Dig rna labelling mix, by Roche (1 mentions) Mmessage mmachine t7 kit, by Thermo Fisher Scientific (1 mentions)

2 protocols using sacii restriction enzyme

Ddx3x mRNA Expression Mapping in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

In situ hybridization was performed as described in Moldrich et al, 2010. The Ddx3x riboprobe was generated in-house using the primers corresponding to those used in the Allen Developing Mouse Brain Atlas (Website: © 2015 Allen Institute for Brain Science. Allen Developing Mouse Brain Atlas [Internet]). Available from: http://developingmouse.brain-map.org): Forward primer: 5’ AAGGGAGCTCAAGGTCACAA 3’, Reverse primer: 5’ CCTGCTGCATAATTCTTCC 3’. Using mouse cortex cDNA, these primers were used to amplify a 908 base pair fragment. This fragment was purified and cloned into pGEM00ae-T Vector System (Promega). The plasmid was then linearized (SacII restriction enzyme, New England BioLabs), purified (PCR Clean up Kit, Qiagen), transcribed (Sp6 RNA Polymerase, New England BioLabs) and digoxigenin-labelled (DIG RNA labelling Mix, Roche) to generate the riboprobe. In situ hybridization against Ddx3x mRNA was performed on 20 μm cryostat sections for embryonic stages and 50 μm vibratome sections for postnatal brains in wildtype CD1 mice.

Lennox A.L., Hoye M.L., Jiang R., Johnson-Kerner B.L., Suit L.A., Venkataramanan S., Sheehan C.J., Alsina F.C., Fregeau B., Aldinger K.A., Moey C., Lobach I., Afenjar A., Babovic-Vuksanovic D., Bézieau S., Blackburn P.R., Bunt J., Burglen L., Campeau P.M., Charles P., Chung B.H., Cogné B., Curry C., D’Agostino M.D., Di Donato N., Faivre L., Héron D., Innes A.M., Isidor B., Keren B., Kimball A., Klee E.W., Kuentz P., Küry S., Martin-Coignard D., Mirzaa G., Mignot C., Miyake N., Matsumoto N., Fujita A., Nava C., Nizon M., Rodriguez D., Blok L.S., Thauvin-Robinet C., Thevenon J., Vincent M., Ziegler A., Dobyns W., Richards L.J., Barkovich A.J., Floor S.N., Silver D.L, & Sherr E.H. (2020). Pathogenic DDX3X mutations impair RNA metabolism and neurogenesis during fetal cortical development. Neuron, 106(3), 404-420.e8.

+ Open protocol

+ Expand

In Vitro Transcription and Electroporation of DENV RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used standard in vitro transcription (IVT) and electroporation of wild-type (WT) and 2′-O-MTase mutant DENV RNA. Briefly, the infectious clone plasmid DNA was linearized with SacII restriction enzyme (New England Biolabs) followed by phenol: chloroform purification and ethanol extraction. The linearized plasmid was used as the template for IVT using the mMESSAGE mMACHINE T7 Kit (Ambion) following the manufacturer's recommended protocols. Equal amounts (10 μg) of full-length IVT RNA was delivered into BHK-21 cells by electroporation (three pulses at 850 V and 25μF) as previously performed (Shi et al., 2002 (link)). The transfected cells were maintained in cell culture flasks for progeny virus collection or seeded on chamber-slides for immunofluorescence assay (IFA) at various time points post-transfection. All cell cultures were maintained in humidified 37 °C and 5% CO₂.

Chang D.C., Hoang L.T., Mohamed Naim A.N., Dong H., Schreiber M.J., Hibberd M.L., Tan M.J, & Shi P.Y. (2016). Evasion of early innate immune response by 2′-O-methylation of dengue genomic RNA. Virology, 499, 259-266.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!