Phusion enzyme

PIPE [64 (link)] was used to generate the plasmids csAP2-pDONR201, pAP2-AP2-pDONR201, pAP2-AP2-Venus-pDONR201, and pAP2-AP2-Venus-pEarlyGate301. All PCR amplifications were done with Phusion Enzyme (New England Biolabs) following the manufacturer’s recommendations. Amplification of the AP2 coding sequence was performed with Q236+Q272 and was cloned into pDONR201 by BP reaction to generate csAP2-pDONR201. Q273+fa20r were used to linearize csAP2-pDONR201, and Q274+Q275 were used to amplify the AP2 promoter to generate pAP2-AP2-Venus-pDONR201. The Venus coding region was amplified using Q058+Q359, and Q357+Q358 were used to linearize pAP2-AP2-Venus-pDONR201 to generate pAP2-AP2-Venus-pDONR201. The pAP2-AP2-Venus sequence was then transferred to the pEarlyGate binary vector [65 (link)] using the Gateway LR clonase II enzyme mix (Invitrogen), according to the manufacturer’s protocol. Transformation of bacteria was performed as described above.

We followed the protocol of Nowacki et al. (2008) (link). Briefly, Turbo DNAse treatment (Thermo AM 2238) was followed by reverse transcription of 3 µg RNA isolated at 12 h using a long primer containing telomeric sequence and a “−RT” control. Subsequent to one-sided PCR, we used a short anchor primer plus one gene-specific primer to test forward and reverse strands independently. PCR was carried out with Phusion enzyme (NEB) for 35 cycles of: 98°C 10 sec (40 sec in the first cycle), 55° 30 sec, 72° 25 sec; followed by 72° for 5 min. Primer sequences are as follows (all 5′–3′):

Reverse transcriptase primer for anchor PCR

 ACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGTCCCCAAAACCCCAAAACCCCAAAA

Anchor primer

 ACTATAGGGCACGCGTGGT

Gene-specific primers:

Contig8682.0_Forward

 GGTTATTGATGCACTTAAATTACACTG

Contig8682.0_Rev

 CCACATGCATGATACTGGATTTTC

Contig13450.0_Forward

 CATATCAACGAGTTGAGAGAGATTC

Contig13450.0_Rev

 TCGAAGAAAGGCTTCTTGAATTGAG

Contig10887.0_Forward

 CTTAAGCTTTCCTGATTTAGTTCCTC

Contig10887.0_Rev

 CTCATAACTGCTCGACGGTTAAAC

Approximately 1.5–2 kb promoter fragments of marker genes identified from FAC sorting and scRNA-seq were PCR amplified using high-fidelity Phusion enzyme (New England BioLabs, Ipswich, Massachusetts, USA) and recombined with Gateway plasmid pDONR P4-P1R. See Supplemental Data Set S42 for primer sequences. Amplification of the correct promoter elements was verified by RE digests and Sanger sequencing with M13F(-21) and M13R primers. Due to the number of sequences being cloned, the promoter fragments were not completely sequenced, and PCR-induced errors in some constructs or variation from the TAIR10 sequence due to differences in our Col-0 strain (e.g. see above) may exist. The plasmids carrying the promoter elements were then recombined with pDONR 221 carrying GUS, pDONR P2R-P3 carrying mCit, and the destination vector pK7m34GW. Col-0 plants were dipped with Agrobacteria carrying the various reporter constructs. Kanamycin-resistant T1 plants growing on medium containing 50 μg/mL kanamycin were imaged.

pAC5.1 Die^RGE-V5 plasmid was generated from the pAC5.1 Die-V5 using overlapping PCR. Briefly, 2 fragments were generated by PCR using pAC5.1 Die-V5 plasmid as template with the following primers: Fragment1 F1: taaggtaccatggcatccccagtagtc, R1: ctcgcactcgcctctgtccatc; Fragment2 F2: gatggacagaggcgagtgcgag, R2: taactcgagaaatggcagcctggt; introducing a mutation in the RGD domain of Diedel, the fragments were then gel purified and fused together using the overlap extension polymerase chain reaction with the Phusion enzyme (NEB, Ipswich, Massachusetts, USA). The fused fragment with the mutation in the RGD motif was isolated with electrophoresis and gel purified, then cloned into the pAC5.1 V5-His plasmid using the restriction enzymes XhoI and KpnI. Integrins Inflated (If) and Myospheroid (Mys) were amplified from cDNA of w1118 L3 larva using specific primers (see S2 Table) and cloned into pMT-puro (Addgene plasmid; #17923).
pAC5.A Flag-Cat plasmid was generated by PCR amplification using specific primer with a Flag tag sequence in 5′ (see S2 Table). Chimeric receptors CD8a and Mys were generated by overlapping PCR (as describe below) using genomic DNA of flies expressing CD8a-mCherry (Bloomington #27391) and the Pmt-Myospheroid plasmid using specific primers (see S2 Table) and then cloned into pMT-puro plasmid.

Full-length TFS1 genomic region was cloned by PCR with Phusion Enzyme (New England Biolabs) according to the manufacturer’s recommendations and used to generate TFS1::TFS1::9xAla-Venus. To introduce 9xAla-Venus coding sequence, we employed Polymerase Incomplete Primer Extension (PIPE) cloning method [72 (link)] and plasmids were then introduced into Agrobacterium to transform Col plants by floral dip [73 (link)]. The sequences of the primers used for PIPE cloning are listed in S2 Table.