Hot firepol blend master mix ready to load

On the GeneXpert device, IMP1, VIM, NDM, KPC, and OXA-48 genes were studied with the Xpert Carba-R kit (Cepheid Inc., USA) as per the guidelines of the manufacturer. Identified resistance genes were verified with the multiplex PCR and gel imaging method. Additionally presence of NDM-1 genes in the strains were verified by multiplex-PCR (Fig. 1).Fig. 1

Results of multiplex PCR-gel imaging on K. pneumoniae strains

The five most common carbapenemase genes (bla_OXA-48, bla_NDM-1, bla_IMP, bla_VIM, and bla_KPC) were investigated by an in-house multiplex PCR test. We used the primers which were previously described in the study by Poirel et al. [12 (link)]. The DNA was extracted by boiling the strains at 95 °C for 5 min. The PCR mixture was constituted of 4 μL master mix (5× HOT FIREPol Blend Master Mix Ready to Load, Solis BioDyne, Estonia), 12 μL dH₂O, 1 μL primer mix (metabion GmBh, Germany), and 3 μL bacterial DNA (total volume 20 μL). The PCR protocol followed was 10 min at 94 °C denaturation; 35 cycles of 30 s at 94 °C, 40 s at 56 °C, and 50 s at 72 °C; and final extension for 5 min at 72 °C. PCR products were dyed with SYBR gold, loaded into 2 % agarose gel, and run on an observable real time electrophoresis (ORTE) instrument (Salubris Technica, Istanbul).

Microsporidia MB specific primers (MB18SF: CGCCGG CCGTGAAAAATTTA and MB18SR: CCTTGGACGTG GGAGCTATC) were used to detect Microsporidia MB in An. arabiensis larvae and adults (Herren et al., 2020 (link)). A 10 μl PCR reaction consisted of 2 μl HOTFirepol^® Blend Master mix Ready-To-Load (Solis Biodyne, Estonia, mix composition: 7.5 mM Magnesium chloride, 2 mM of each dNTPs, HOT FIREPol^® DNA polymerase), 0.5 μl of 5 pmol μl^–1 of forward and reverse primers, 2 μl of the template and 5 μl nuclease-free PCR water was undertaken. Conditions used were initial denaturation at 95°C for 15 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 62°C for 90 s and extension at 72°C for a further 60 s. Final elongation was done at 72°C for 5 min. The intensity of Microsporidia MB infection was determined by a qPCR assay using MB18SF/MB18SR primers. These were normalized against the Anopheles ribosomal S7 host gene primers (S7F: ⁵′TCCTGGAGCTGGAGATGAAC³′ and S7R ⁵′GACGGGTCTGTACCTTCTGG³′, Dimopoulos et al., 1998 (link)).

For PCR amplification, we adapted specific genotyping primers for the surface genomic region from INNO-LiPA HBV genotyping assay (Fujirebio US, Inc., Malvern, PA, USA), [24 (link)]. PCR amplification was performed using the primers: HBPr134 (5′-TGCTGCTATGCCTCATCTTC-3′) and HBPr135 (5′-CARAGACARAA-GAAAATTGG-3′) for direct PCR, HBPr75 (5′-CAAGGTATGTTGCCCGTTTGTCC-3′) and HBPr94 (5′-GGYAWAAAGGGACTCAMGATG-3′) for nested PCR, and 5 x HOT FIREPol^® Blend Master Mix Ready to Load (Solis BioDyne, Tartu, Estonia) and 5 μL of DNA samples were also used for direct and 2 μL (products of the direct round PCR) for nested PCR. Amplification was performed in a standard thermocycler (T1Thermocycler, Biometra GmbH, Göttingen, Germany), and the thermal cycling parameters used were: initial denaturation −95 °C for 12 min and 30 cycles of 95 °C for 20 s, 52 °C for 40 s, 72 °C for 60 s, and a final elongation of 72 °C for 10 min. The thermal cycling parameters were the same for both the direct and nested PCR. PCR products were visualized using 1% agarose gel electrophoresis. Nested PCR was performed only if direct PCR was not sufficient. Generally, the first round of PCR was sufficient, and the nested (second round) PCR was needed only five time. We obtained 409 bp products from direct and 341 bp from nested PCR.

Genomic DNA extracted from individual whole specimens using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) was used to identify by PCR the sibling species as well as probing for Plasmodium infection and host blood-meal sources. We identified species of the An. funestus group using an established cocktail of primers [10 (link), 11 (link)], as previously described [3 (link)]. Briefly, PCRs were conducted on a SimpliAmp Thermal Cycler (Applied Biosystems, Loughborough, UK) in a 15 μl reaction volume containing 0.5 μM each of the primers, 3 μl of 5× Hot Firepol Blend Master Mix Ready to Load (Solis BioDyne, Tartu, Estonia) and 2 μl of DNA template. The cycling parameters were: initial denaturation at 95 °C for 15 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 30 s and extension at 72 °C for 40 s, and a final extension at 72 °C for 10 min. Size fragments characteristic of each species were scored after separation in agarose gel electrophoresis (1.5%) stained with ethidium bromide against a 100 bp DNA ladder (O’ Gene Ruler, Fermentas, Fisher Scientific, Loughborough, UK).

We extracted genomic DNA from individual whole specimens using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) as per the manufacturer’s instructions. The DNA was used for identification of the sibling species as well as probing for Plasmodium infection and host blood meal sources.
Molecular identification of member species of the An. funestus complex involved polymerase chain reaction (PCR) amplification of the polymorphic ITS2 region of ribosomal DNA using established primers [16 (link), 17 (link)]. The PCR in a 15 μl reaction involved 0.5 μM each of the primers, 3 μl of 5× Hot Firepol Blend Master Mix Ready to Load (Solis BioDyne, Tartu, Estonia) and 2 μl of DNA template. PCR cycling conditions were as follows: initial denaturation at 95 °C for 15 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 46 °C for 30 s and extension at 72°C for 40 s, and a final extension at 72 °C for 10 min. Thermal reactions were conducted on SimpliAmp Thermal Cycler (Applied Biosystems, Loughborough, UK). Size fragments characteristic of each species were distinguished after separation in agarose gel electrophoresis (1.5%) stained with ethidium bromide against a 100 bp DNA ladder (O’ Gene Ruler, Fermentas, Fisher Scientific, Loughborough, UK).