The largest database of trusted experimental protocols

23 protocols using dharmafect 4 transfection reagent

1

Silencing AMPK and TSC2 in HepG2 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cell signaling was targeted with specific siRNA silencing of AMPK (30 nM; Sigma-Aldrich) or TSC2 (100 nM; Sigma-Aldrich) using Dharmafect transfection reagent 4 (Cat #T-2004, Thermo Fisher Scientific). HepG2 cells were then treated with control scramble siRNA (Cat #SIC001, Sigma-Aldrich) or specific siRNA targeting AMPK or TSC2 in 10% FBS DMEM–F-12 media for 24 h. Cell media was subsequently exchanged for 10% FBS DMEM–F-12 media for 24 h and then cells were serum-starved with 0% FBS DMEM–F-12 media for 6 h. Cells were treated with control or glucose deprivation media as described earlier. Both cell media and lysate were collected for analyses, and the efficiency of target silencing was determined at the protein level using western blot analysis.
+ Open protocol
+ Expand
2

Cx43 Knockdown in 4T1 and MMT Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
4T1 and MMT cells were seeded in a 12-well plate at a density of 60 × 103/well, in the presence of siRNA duplex (Dharmacon, Thermo Fisher Scientific). ON-Target plus nontargeting siRNA (D-001810-10) and two Cx43-specific targeting sequences (J-051694-05 and J-051694-06) were used at a final concentration of 50 nM using Dharmafect transfection reagent 4 (Thermo Fisher Scientific). After 12 h, RNAi containing supernatant was removed and replaced by penicillin/streptomycin free media. After a recovery period of at least 6 h, cells were used for spheroid generation. For assessment of knockdown efficiency, whole-cell lysates were analyzed after 24, 48, and 72 h after removal of siRNA by Western blot.
+ Open protocol
+ Expand
3

Investigating MCAM and PECAM Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sub-confluent HUVECs cultured in 12-well plates were treated with 150 pmol MCAM, PECAM siRNA (siGenome Smart pool human MCAM and PECAM, Thermo Fisher) or control non-target siRNA (siGenome control siRNA #1, Thermo Fisher) in serum-free medium for 5 min before addition of 2.5 μl DharmaFect Transfection Reagent-4 (Thermo Fisher) in 100 µl serum-free medium for 20 min at room temperature. After addition of 800 μl EGM, cells were incubated for 16 h at 37°C before the medium was replaced with fresh medium for a further 24 h. The cells were either lysed by SDS-sample buffer for analysis of MCAM and PECAM expression by immunoblotting, or introduced with 4 μg/ml PNA or BSA for 24 h at 37°C before IL-6 and MCP-1 concentrations in the culture media were determined by ELISA.
+ Open protocol
+ Expand
4

HIF-1α Silencing in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cells were plated and allowed to grow to ~60% confluency. Cells were transfected with HIF-1α siRNA (5’-CCAGCCGCTGGAGACACAATCATAT-3’; 40 nM) (Ambion Cat. #4390824, Thermo Fisher Scientific, Waltham, MA, USA) using Dharmafect transfection reagent 4 (Thermo Fisher Scientific, Waltham, MA, USA) as described previously26 (link). Immediately after transfection, cells were cultured for 48 hours in normoxia (20% O2, 5% CO2; incubator air) for maximal silencing. Cells were then serum-starved overnight and treated for 24 hours in either normoxia or hypoxia (in a hypoxia chamber as described). The efficiency of target silencing was determined at the protein level using western blot analysis.
+ Open protocol
+ Expand
5

Zip7 siRNA Knockdown in NIH 3T3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse NIH 3T3 cells (6×105/mm2) were cultured for 24 h in DMEM supplemented with 10% FBS, 1% 20 U/mL penicillin, 34.4pM streptomycin, 1% L-Glutamine, 1% HEPES and 1% non essential amino acids. Transfection was achieved with DharmaFECT transfection reagent 4 (Thermo Scientific) and 100 nM Stealth Select RNAi siRNA specific to Zip7 (oligo ID MSS205001) or Negative control High GC siRNA (both from Life Technologies) according to manufacturer specifications. siRNA-transfection reagent complexes were incubated for 20 min in DMEM prior to dropwise addition to cells. Cell media was changed after 24 h to DMEM containing 10% FBS. 72 h after transfection, cells were harvested for Western blotting by scraping and centrifugation (18,000×g, 5 min).
+ Open protocol
+ Expand
6

Silencing Regulators of Cellular Growth

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cells were plated at 65% confluence in 12-well culture plates. Silencing using siRNA against raptor+rictor, DEPTOR, GCN2 (Sigma-Aldrich, St Louis, MO, USA) or ERK (Cell Signaling Technologies, Beverly, MA, USA) in HepG2 cells was achieved using transfection17 (link) with 100 nM siRNA and 5 μL Dharmafect transfection reagent 4 (Thermo Scientific, Rockford, IL, USA) in regular, serum free DMEM:F12. To simultaneously ensure maximal silencing and maximize cell survival, the transfected cell media was replaced after 24 hours with specialized leucine plus or leucine deprived media and studied after 72 hours (96 hours following transfection). Western immunoblot analysis was used to determine the efficiency of target silencing.
+ Open protocol
+ Expand
7

Human PKC-α Knockdown in HBMEC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Subconfluent cells were transfected with ON-TARGET plus SMARTpool human PKC-α (50 nM) or non-targeting (50 nM) siRNA using DharmaFECT transfection reagent 4 (Thermo Scientific) for 16 hours on day one after which the transfection reagent was replaced with HBMEC cell media. On day three the transfection was repeated after which the cells were used in relevant experiments. The sequences of the oligonucleotides used in PKC-α SMARTpool were: UCACUGCUCUAUGGACUUA, GAAGGGUUCUCGUAUGUCA, UUAUAGGGAUCUGAAGUUA and UAAGGAACCACAAGCAGUA.
+ Open protocol
+ Expand
8

Overexpression and Knockdown of HSET in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HeLa-HSET-GFP cells were generously provided by Claire Walczak (Indiana University). HeLa, HeLa-HSET-GFP and MDA-MB-231 cells were grown in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. Briefly, cells were seeded onto 100-mm plates 1 day prior to transfection. Plasmid DNA (5 μg) and 15 μl of DharmaFECT 4 transfection reagent (Thermo Scientific, PA, USA) were used for each transfection. HSET-pEGFP plasmid was generously provided by Dr. Walczak. Cells overexpressing HSET were selected in the medium containing G418 (400 μg/ml). The G418-resistant colonies were collected and examined for HSET expression. SMARTpool: ON-TARGETplus KIFC1 siRNA (Dharmacon, PA, USA) was used to knockdown HSET in MDA-MB-231 cells.
+ Open protocol
+ Expand
9

Stable RFX-1 Silencing Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RFX-1 silencing stable cell line, PLC5-shRFX-1, was obtained by transfection of HuSH-shRNA-GFP cloning vector (pGFP-V-RS) or HuSH-shRFX-1-GFP cloning vector (pGFP-V-RS-shRFX-1) into PLC5 cells using Dharmafect 4 transfection reagent (Thermo Scientific). Two days post-transfection, the PLC5-sh-control (sh-vector clone 1 and 2) and the PLC5-sh-RFX-1 (sh-RFX-1 clone 1: TGCGGCTGATGGAGGACCAGCAGCACATG and sh-RFX-1 clone 2: CCTCAAGTGGTCCTTCTACAGCTCCATGG) cells were selected and placed in medium containing 1.5 μg/ml puromycin for 2 weeks. Cells were routinely maintained under constant culture conditions. Control and shRNA plasmids were purchased from Origene.
+ Open protocol
+ Expand
10

FASN Gene Silencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Predesigned FASN siRNAs were from Millipore Sigma (#1, SASI_Hs01_00057850; #2, SASI_Hs01_00057851; #3, SASI_Hs02_00336920; #4, SASI_Hs01_00057849). A custom siRNA library (Supplementary Data 9), universal MISSION® siRNA Universal Negative Control #1 (cat. SIC001) and #2 (cat. SIC002) were from Millipore Sigma. We used the DharmaFECT 4 Transfection Reagent (Thermo Scientific) for siRNA transfection. RNA was extracted using TRIzol Reagent (cat. 15596, Life Technologies) and retrotranscribed using iScript cDNA Synthesis kit (cat. 170-8891, Bio-rad). Knock-down efficiency was evaluated 48 h after transfection via real-time PCR using the PowerUPTM SYBR® Green Master Mix (cat. A25742, Thermo Fisher Scientific) and custom designed primers (Supplementary Data 9).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!