Qrt pcr primers

Total RNA was extracted and reverse transcribed into cDNA with 5 × All-In-One RT MasterMix (G490, Applied Biological Materials Inc., Richmond, Canada) according to the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) was performed on a PikoReal Real-Time PCR System using the DyNAmo™ ColorFlash SYBR Green qPCR Kit (Thermo Fisher Scientific) and analyzed with PikoReal 2.0 software. The primer sequences are shown in Table S3. MiRNA quantification was determined by the miDETECT A Track qRT-PCR Starter Kit (RiboBio, Guangzhou, China) according to the manufacturer’s instructions. The qRT-PCR primers specific for miR-22-3p and U6 were designed by RiboBio.

Total RNA was extracted using the Trizol reagent (Invitrogen) according to the manufacturer’s standard protocol. The first cDNA strand was generated using a random primer and Moloney Murine Leukemia Virus Reverse Transcriptase (Promega). Real-time PCR was conducted with SYBR Green Master Mix (Bio-Rad) on the CFX96 touch real-time PCR detection system (Bio-Rad). GAPDH mRNA was measured as a control for the expression of level of DLEU2, pri-miR-16-1, CCND1, CCNE1 and EV71 genomic RNA. U6 rRNA serves as internal control for the expression level of hsa-miR-16-5p.The specific primer sequences are as follows: pri-miR-16-1, F (CCTTGGAGTAAAGTAGCAGCACATAATG), R (ATATACATTAAAACACAACTGTAGAGTATG); DLEU2, F(TGAAGATGTCTTTTGAAAGGTGTAC), R (ACTTTTTCCATGAGGAGGTACAGT); CCND1, F (CTGTGCATCTACACCGACAACT), R (GCATTTTGGAGAGGAAGTGTTC); CCNE1, F (TGTGTCCTGGATGTTGACTGCC), R (CTCTATGTCGCACCACTGATACC); GAPDH, F (GTCTCCTCTGACTTCAACAGCG), R (ACCACCCTGTTGCTGTAGCCAA); EV71 (BrCr), F(GAGAGTTCTATA GGGGACAGT), R(AGCTGTGCTATGTGAATTAGGAA); EV71 (GZ-CII), F (GATAGGGTGGCAGATGTAAT), R (CACAGCGTGTCTCAATCA) and mouse GAPDH, F(AACGACCCCTTCATTGAC), R (TCCACGACATACTCAGCAC). Hsa-miR-16-5p specific bulge-loop miRNA qRT-PCR primers were purchased from Ribo Biotechnology (Guangzhou, China). Data analysis was performed using the 2^−ΔΔCt method.

RNA expression was detected through qRT‐PCR. To isolate total RNA, TRIzol™ Reagent (Invitrogen) was adopted, while ExoQuick® Exosome RNA Column Purification Kit (System Biosciences, Palo Alto, CA, USA) was adopted for exosomal RNA extraction. DNase I, Amplification Grade (Invitrogen) was applied to digest DNA contaminants. Nanodrop™ 2000 spectrophotometer (Thermo Scientific) was used to detect the concentration and quality of RNA samples. RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) (for mRNA and lncRNA) and TaqMan MicroRNA Assays (Applied Biosystems, Waltham, MA) (for miRNA) was applied for synthesizing complementary DNAs (cDNAs) from 1 μg of RNA samples. qRT‐PCR was performed on CFX96 Touch Real‐Time PCR Detection System (Bio‐Rad, Hercules, CA, USA) using SYBR™ Green PCR Master Mix (Applied Biosystems). All data were normalized to the internal control GAPDH or U6, and 2^–ΔΔCt method was used for relative expression quantification. The sequences of qRT‐PCR primers (RiboBio) are presented in Supporting information Table S2.