Lipid nanoparticles (LNPs) for siRNA transfection were formulated by 1,2-dioleoyl-3-trimethylammonium-propane, cholesterol, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (Avanti Polar Lipids), and synthesized using a thin-film rehydration and sonication method. pd-l1 siRNA (Sigma) was encapsulated into LNP by co-incubation in HEPES buffer for 30 minutes at room temperature. MDSCs were lifted and re-plated at 106 cells/mL/well in 24-well plates and were allowed to adhere overnight. MDSCs were incubated with siRNA (pd-l1 or scramble)/LNP complex in Opti-MEM at siRNA concentration of 100 nM for 4 hours at 37 °C. The medium was replaced by complete RPMI and the cells were cultured for 24 hours at 37 °C. RNA was isolated from siRNA treated MDSCs using the RNEasy Plus Mini Kit (Qiagen). Following chloroform extraction, samples were loaded onto RNeasy Plus columns (Qiagen) and processed according to the manufacturer’s protocol. Total RNA was quantified using a Nanodrop apparatus (Thermo Scientific) and then converted to cDNA using the iScript cDNA synthesis kit (Bio-Rad). pd-l1 and control β-actin transcripts were analyzed by using the 2–ΔΔCT method. Murine pd-l1 primers: forward TGCTGCATAATCAGCTACGG; reverse CCACGGAAATTCTCTGGTTG (18 (link)). Murine β-actin primers: forward TTGCTGACAGGATGCAGAAG; reverse ACATCTGCTGGAAGGTGGAC (19 (link)).
Pd l1 sirna
Manufactured by Merck Group
Sourced in Macao
PD-L1 siRNA is a laboratory product used for gene silencing. It is a synthetic small interfering RNA (siRNA) designed to target and downregulate the expression of the PD-L1 (Programmed Death-Ligand 1) gene. The core function of this product is to serve as a research tool for studying the role of PD-L1 in various biological and disease-related processes.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy plus column, by Qiagen (1 mentions)
Nanodrop apparatus, by Thermo Fisher Scientific (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Luciferase assay kit, by Promega (1 mentions)
Pd 1 sirna, by Merck Group (1 mentions)
Control sirna, by Merck Group (1 mentions)
Magnesium chloride hexahydrate, by Thermo Fisher Scientific (1 mentions)
Aluminum chloride hexahydrated, by Thermo Fisher Scientific (1 mentions)
4 protocols using pd l1 sirna
1
Lipid Nanoparticle Transfection of PD-L1 siRNA
2
Luciferase Assay for α-SMA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The luciferase assay was conducted similarly to previously described53 (link),54 (link). Briefly, primary HLFs were transfected with α-SMA reporter plasmids with scramble or PD-L1 siRNA from Sigma (St. Louis, MO) in a 24-well plate, followed by collection of lysates 12 h after TGF-β treatment. The luciferase activity measurement was done according to the instructions of the luciferase assay kit from Promega (Madison, MI). The measurement of luciferase activity was performed using a Sirius 2 luminometer (Berthold Technologies USA, Oak Ridge, TN). The readings were adjusted by the corresponding protein concentrations and data were shown as relative numbers to the control group.
3
Immunotherapy Study Using PD-1/PD-L1 Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TC-1 cells expressing HPV16 and HPV-E7 proteins and OVA-expressing EG7 cells (EL4 cell line transfected with the gene encoding OVA) were cultured in RPMI 1640 medium supplemented with 10% FBS and 0.1% gentamycin. PD-1 siRNA (sense: CACUUCUAGGGACUUGAGA, antisense: UCUCAAGUCCCUAGAAGUG), PD-L1 siRNA (sense: GACUCAAGAUGGAACCUGA, antisense: UCAGGUUCCAUCUUGAGUC), and control siRNA (sense: TTCTCCGAACGTGTCACGT, antisense: ACGTGACACGTTCGGAGAA) were purchased from Sigma-Aldrich.
4
Nanoparticle-based Nucleic Acid Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples
were prepared under sterile conditions. Sodium hydroxide pellets,
magnesium chloride hexahydrate (MgCl2·6H2O), and aluminum chloride hexahydrated (AlCl3·6H2O) were purchased from Ajax Finechem, and Sigma-Aldrich Pty
Ltd, respectively. dsDNA-Cy3 was purchased from GeneWorks. CD-siRNA
was purchased from QIAGEN Pty. Ltd. PD-L1 siRNA (sense: 5′-AGAcGuAAGcAGuGuuGAAdTsdT-3′
and antisense: 5′-UUcAAcACUGCUuACGUCUdTsdT-3′) and other
chemicals and reagents were purchased from Sigma-Aldrich if not illustrated
specifically. Water used in experiments was deionized Milli-Q water.
were prepared under sterile conditions. Sodium hydroxide pellets,
magnesium chloride hexahydrate (MgCl2·6H2O), and aluminum chloride hexahydrated (AlCl3·6H2O) were purchased from Ajax Finechem, and Sigma-Aldrich Pty
Ltd, respectively. dsDNA-Cy3 was purchased from GeneWorks. CD-siRNA
was purchased from QIAGEN Pty. Ltd. PD-L1 siRNA (sense: 5′-AGAcGuAAGcAGuGuuGAAdTsdT-3′
and antisense: 5′-UUcAAcACUGCUuACGUCUdTsdT-3′) and other
chemicals and reagents were purchased from Sigma-Aldrich if not illustrated
specifically. Water used in experiments was deionized Milli-Q water.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!