Pfn21a halotag cmv flexi

To generate different constructs of AR FL (12Q), AR FL (55Q), and AR45, we PCR-amplified the AR FL (12Q), AR FL (55Q), and AR45 cDNAs from their respective expression construct and cloned the PCR amplicons separately into a mammalian expression vector under the control of the CMV promoter with or without an N-terminal FLAG epitope tag. To generate NanoBRET fusion constructs, these PCR amplicons were cloned separately into pFN21A HaloTag CMV Flexi, pFC14K HaloTag CMV Flexi, pFN31K Nluc CMV-neo Flexi, and pFC32K Nluc CMV-neo Flexi vectors via Sgf I and Pme I or Sgf I and Eco ICRI following the manufacturer’s protocol (Promega). The mutant constructs with mutations at the FxxLF motif (F23,27A/L26A) or (G21E), at the D-box (A596T/S597T), or at the DBD (A574D) of AR were generated by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). All plasmids were sequence-verified.

ENTREP cDNA was amplified from MCF‐7 cells using high‐fidelity PrimeSTAR GXL DNA polymerase (TAKARA) and cloned into the pBluescript II plasmid (Agilent). The following PCR primers were used for amplification: forward primer, 5′‐ccggaattcggtcgccaccatgatactcctggtaaacctctttgtg‐3′; reverse primer, 5′‐acgcgtcgactcacaggacagtctctcggatgac‐3′. The sequence was identical to that of FAM189A2 isoform b (NM_001127608.3) and was registered as ENTREP under accession number LC496047.1 in the DDBJ/EMBL‐EBI/GenBank database. The pRK5‐HA‐Ubiquitin plasmids were kind gifts from Dr. Ted Dawson (Johns Hopkins University) through Addgene. The plasmid vectors encoding human ENTREP, ITCH, EPN1, and CXCR4 were constructed from pcDNA3.1‐myc/HIS (Invitrogen), pCMVTNT, pFN21A HaloTag CMV Flexi (Promega), pEGFP, and pDsRed‐monomer vectors (Clontech). The expression vectors were schematically presented in Appendix Fig S2. The lentiviral expression vector pCSII‐CMV‐MCS‐IRES2‐Bsd, as well as pCAG‐HIVgp and pCAG‐VSV‐G‐RSV‐REV, was a kind gift from Dr. Hiroyuki Miyoshi (Riken BioResource Research Center, Japan). Transient transfection of plasmids was carried out using Lipofectamine PLUS reagent (Invitrogen) or Viafect (Promega) according to the manufacturer’s protocol.

Human PALLD, MYPN, FHOD1, and ANKRD1 cDNAs, isolated by PCR using available constructs or a human cDNA library as a template, were cloned into pGBKT7 DNA-BD (Takara Bio), pGADT7-AD (Takara Bio), pFN21A HaloTag CMV Flexi (Promega), pNLF1-N [CMV Hygro] (Promega), and pNLF1-C [CMV Hygro] (Promega) vectors using restriction cloning or the In-Fusion HD Cloning Plus kit (Takara Bio) according to the manufacturer’s instructions. Primer sequences are listed in Supplementary file 1. All constructs were confirmed by sequencing.