Cfx96 c1000 qpcr machine
The CFX96/C1000 qPCR machine is a real-time PCR detection system designed for quantitative gene expression analysis. It features a 96-well format and is capable of accurately measuring fluorescent signals during the thermal cycling process.
Lab products found in correlation
9 protocols using cfx96 c1000 qpcr machine
Quantifying Mitochondrial DNA Levels
Quantifying Mitochondrial DNA Dynamics
Quantifying Mitochondrial DNA Deletions
Quantitative Assessment of Mitochondrial DNA
Quantifying mtDNA Levels via qPCR
Quantitative PCR Analysis of Mitochondrial DNA
Quantitative mtDNA Analysis using qPCR
Quantitative Analysis of mtDNA Levels
Quantifying UQCRFS1 Deletion in Cortex and Hippocampus
Quantitative PCR reactions done using SYBR chemistry (SsoAdvanced Universal Master Mix SYBR Green, Bio-Rad) were performed on a Bio-Rad CFX96/C1000 qPCR machine. The comparative ddCt method was used to determine the relative levels of undeleted and deleted UQCRFS1 to a control genomic region (40) . To estimate the levels of "undeleted UQCRFS1" we designed primers to amplify a region in Exon 2 of levels UQCRFS1 (F:AACCAAGATGAGTACAGACA, R:AGAACCAAGAAGGAGATTGA); to estimate the levels of "deleted UQCRFS1" we designed primers in the intron sequences flanking Exon 2 of UQCRFS1 (F:TCATCCGAGACCCAGCAA, R:AGCACATAGCAGAGATACAA). Primers for beta-Actin were (F:GCGCAAGTACTCTGTGTGGA, R:CATCGTACTCCTGCTTGCTG).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!