Cyanine 5 dutp

Genomic DNA was extracted from An. stephensi HP10 hindgut mosquitoes and amplified with GAL4-specific primers (Gal4clone_F—AAGAAAAACCGAAGTGCGCC and Gal4clone_R—CACCAAACAAAGCAGACGGG). About 30 ng of the purified PCR product was used in a Random-primer labeling reaction, in which Cyanine 5-dUTP (Enzo Life Sciences Inc., Ann Arbor, MI, USA) was incorporated into the DNA by Klenow fragment (ThermoScientific, Graiciuno, Lithuania) and Random Primers DNA Labeling System (Invitrogen, Carlsbad, CA, USA). The manufacture-supplied protocol for the Random Primers DNA Labeling System was used. The labeled DNA was precipitated by 2.5 volumes of 96% Ethanol and 0.1 volume of 3 M sodium acetate at −20 °C overnight and then centrifuged at 14,000 g, 4 °C for 20 min. The supernatant was removed, and the pellet of DNA was air-dried and dissolved in 50 μl of hybridization buffer (60% deionized formamide, 2 × SSC, 10% dextran sulfate) by shaking the mix in the Eppendorf ThermoMixer C (MilliporeSigma, St. Louis, MO, USA) at 2000 rpm, 37 °C for 1 h.

Probes for FISH were generated using a modified conventional PCR: the reaction mix with a final volume of 25 μl contained 0.1 mM each of unlabelled dATP, dCTP and dGTP and 0.03 mM of dTTP; 0.5 μl one fluorophore conjugated dUTP (cyanine 3-dUTP (Enzo), cyanine 5-dUTP (Enzo) or fluorescein-12-dUTP (Thermo Fisher Scientific)); 1× Taq-buffer; and 0.625 U GoTaq DNA Polymerase (Promega). Each PCR amplification was performed using 0.5 μg of genomic DNA template from testes, 34 PCR cycles and a 30-s extension step to obtain appropriately sized probes for FISH. After cycling the reaction, 25 μl PCR mix was combined with 5 μl sheared salmon sperm DNA (1 mg ml⁻¹; Thermo Fisher Scientific), 3 μl 3 M sodium acetate, pH 5.2 and 80 μl 100% cold ethanol, and kept overnight at −20 °C for probe precipitation. After spinning and supernatant removal, the pellet was dissolved in 25–30 μl of 50% formamide and stored at −20 °C before use.